Mutagenetix > Incidental Mutation

Incidental Mutation 'R2891:Vpreb3'

260103

Institutional Source

Beutler Lab

Gene Symbol

Vpreb3

Ensembl Gene

ENSMUSG00000000903

Gene Name

V-set pre-B cell surrogate light chain 3

Synonyms

8HS-20, Vpreb-3

MMRRC Submission

040479-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2891 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75778891-75785491 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 75779056 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151812 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121151] [ENSMUST00000219979]

AlphaFold

D3Z6J4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059658

SMART Domains

Protein: ENSMUSP00000055979
Gene: ENSMUSG00000050157

Domain	Start	End	E-Value	Type
Pfam:Il2rg	2	89	6.7e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117331

Predicted Effect

unknown
Transcript: ENSMUST00000121151
AA Change: A2V

SMART Domains

Protein: ENSMUSP00000113205
Gene: ENSMUSG00000000903
AA Change: A2V

Domain	Start	End	E-Value	Type
IGv	43	124	1.81e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000219979

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of the mouse VpreB3 (8HS20) protein, is thought to be involved in B-cell maturation, and may play a role in assembly of the pre-B cell receptor (pre-BCR). While the role of this protein in B-cell development has not yet been elucidated, studies with the chicken ortholog of this protein have found that when overexpressed, this protein localizes to the endoplasmic reticulum. The mouse ortholog of this protein has been shown to associate with membrane mu heavy chains early in the course of pre-B cell receptor biosynthesis. Expression of this gene has been observed in some lymphomas. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,841,366 (GRCm39)	Y816H	probably damaging	Het
Clcn6	C	T	4: 148,097,073 (GRCm39)		probably null	Het
Farp1	C	T	14: 121,494,148 (GRCm39)	A543V	probably damaging	Het
Hhat	T	C	1: 192,277,394 (GRCm39)	Y355C	probably damaging	Het
Ireb2	A	T	9: 54,807,274 (GRCm39)	H612L	probably benign	Het
Kcnj3	A	T	2: 55,337,027 (GRCm39)	I298F	probably damaging	Het
Kdr	A	G	5: 76,107,496 (GRCm39)	F1016L	probably damaging	Het
Klf7	T	C	1: 64,081,521 (GRCm39)	Y269C	probably damaging	Het
Klhl9	T	C	4: 88,639,207 (GRCm39)	I345V	probably benign	Het
Miga2	A	T	2: 30,268,306 (GRCm39)		probably null	Het
Nadk	A	G	4: 155,671,817 (GRCm39)	N232S	possibly damaging	Het
Ncoa6	T	A	2: 155,279,881 (GRCm39)	D45V	possibly damaging	Het
Pcnx2	A	G	8: 126,617,797 (GRCm39)	S153P	probably damaging	Het
Per2	C	A	1: 91,373,325 (GRCm39)	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,364,500 (GRCm39)	A73V	probably benign	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Rapsn	A	T	2: 90,867,169 (GRCm39)	D157V	probably damaging	Het
Shprh	T	G	10: 11,040,100 (GRCm39)	S4R	probably damaging	Het
Taar8a	G	A	10: 23,953,028 (GRCm39)	V211I	probably benign	Het

Other mutations in Vpreb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Vpreb3	APN	10	75,784,231 (GRCm39)	missense	probably benign
IGL02051:Vpreb3	APN	10	75,784,244 (GRCm39)	critical splice donor site	probably null
IGL03162:Vpreb3	APN	10	75,785,133 (GRCm39)	missense	probably damaging	1.00
R2319:Vpreb3	UTSW	10	75,779,056 (GRCm39)	unclassified	probably benign
R2892:Vpreb3	UTSW	10	75,779,056 (GRCm39)	unclassified	probably benign
R2894:Vpreb3	UTSW	10	75,779,056 (GRCm39)	unclassified	probably benign
R3438:Vpreb3	UTSW	10	75,779,056 (GRCm39)	unclassified	probably benign
R3439:Vpreb3	UTSW	10	75,779,056 (GRCm39)	unclassified	probably benign
R3508:Vpreb3	UTSW	10	75,785,037 (GRCm39)	missense	probably benign	0.26
R3725:Vpreb3	UTSW	10	75,779,125 (GRCm39)	critical splice donor site	probably null
R3726:Vpreb3	UTSW	10	75,779,125 (GRCm39)	critical splice donor site	probably null
R3771:Vpreb3	UTSW	10	75,775,800 (GRCm39)	missense	probably benign	0.00
R4975:Vpreb3	UTSW	10	75,775,636 (GRCm39)	missense	probably damaging	1.00
Z1177:Vpreb3	UTSW	10	75,785,027 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCTTCCTTGAACAGCCC -3'
(R):5'- CGCAAACCAAGTATGCAACTGG -3'

Sequencing Primer
(F):5'- TGAACAGCCCCCAGTTTG -3'
(R):5'- CTTTCCTATAAAGGGTGAGCACAC -3'

Posted On

2015-01-23