Incidental Mutation 'R2892:Plrg1'
ID260116
Institutional Source Beutler Lab
Gene Symbol Plrg1
Ensembl Gene ENSMUSG00000027998
Gene Namepleiotropic regulator 1
SynonymsTango4
MMRRC Submission 040480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2892 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83055522-83072355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83071240 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 438 (Q438K)
Ref Sequence ENSEMBL: ENSMUSP00000113614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029628] [ENSMUST00000122128] [ENSMUST00000150268]
Predicted Effect probably benign
Transcript: ENSMUST00000029628
SMART Domains Protein: ENSMUSP00000029628
Gene: ENSMUSG00000027998

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122128
AA Change: Q438K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113614
Gene: ENSMUSG00000027998
AA Change: Q438K

DomainStartEndE-ValueType
WD40 183 222 1.92e-10 SMART
WD40 225 264 1.68e-6 SMART
WD40 267 306 1.96e-7 SMART
WD40 309 348 5.95e-7 SMART
WD40 351 389 1.12e-2 SMART
WD40 392 430 5.47e-6 SMART
WD40 442 480 5.97e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135813
Predicted Effect possibly damaging
Transcript: ENSMUST00000150268
AA Change: Q447K

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114968
Gene: ENSMUSG00000027998
AA Change: Q447K

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
WD40 360 398 1.12e-2 SMART
WD40 401 439 5.47e-6 SMART
WD40 451 489 5.97e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151915
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Atp6v0a4 T C 6: 38,053,017 E704G probably benign Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Olfr845 A G 9: 19,338,738 T93A probably benign Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pde8b T C 13: 95,034,259 D633G probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Trim80 A G 11: 115,448,023 T560A possibly damaging Het
Ttll2 T C 17: 7,352,699 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Plrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Plrg1 APN 3 83070673 missense probably damaging 0.99
IGL00824:Plrg1 APN 3 83068335 missense probably damaging 1.00
IGL00948:Plrg1 APN 3 83068119 missense probably damaging 1.00
IGL02550:Plrg1 APN 3 83061123 critical splice donor site probably null
R0743:Plrg1 UTSW 3 83059917 missense probably benign 0.11
R1624:Plrg1 UTSW 3 83067994 splice site probably benign
R1624:Plrg1 UTSW 3 83069744 missense probably damaging 1.00
R1630:Plrg1 UTSW 3 83058763 missense probably benign 0.00
R1876:Plrg1 UTSW 3 83069068 splice site probably benign
R2383:Plrg1 UTSW 3 83065948 missense probably damaging 1.00
R3406:Plrg1 UTSW 3 83071219 missense probably damaging 1.00
R5114:Plrg1 UTSW 3 83071251 missense probably benign 0.13
R5922:Plrg1 UTSW 3 83056848 missense possibly damaging 0.77
R6333:Plrg1 UTSW 3 83056795 missense probably damaging 1.00
R7127:Plrg1 UTSW 3 83059915 missense probably damaging 1.00
R7530:Plrg1 UTSW 3 83058682 missense probably damaging 1.00
R7814:Plrg1 UTSW 3 83056837 missense probably damaging 1.00
R8123:Plrg1 UTSW 3 83065930 missense probably benign 0.16
R8131:Plrg1 UTSW 3 83069774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGCCTGATGTTTGGT -3'
(R):5'- CAGACAGACAGAGATGGACACT -3'

Sequencing Primer
(F):5'- AAAGAGATAGTGTGTGTGTGTGAG -3'
(R):5'- GAGATGGACACTAAGAACTTACCGC -3'
Posted On2015-01-23