Incidental Mutation 'R2892:Atp6v0a4'
ID 260124
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
MMRRC Submission 040480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2892 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38053017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 704 (E704G)
Ref Sequence ENSEMBL: ENSMUSP00000110558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably benign
Transcript: ENSMUST00000040259
AA Change: E704G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: E704G

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114908
AA Change: E704G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: E704G

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135594
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Olfr845 A G 9: 19,338,738 T93A probably benign Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pde8b T C 13: 95,034,259 D633G probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plrg1 C A 3: 83,071,240 Q438K probably damaging Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Trim80 A G 11: 115,448,023 T560A possibly damaging Het
Ttll2 T C 17: 7,352,699 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9007:Atp6v0a4 UTSW 6 38053053 missense probably benign
R9359:Atp6v0a4 UTSW 6 38082113 missense probably benign 0.21
R9475:Atp6v0a4 UTSW 6 38060982 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTTTCTGAAACCTTCTGACTAAG -3'
(R):5'- CTAGCTGACATTGAGTGAGGGC -3'

Sequencing Primer
(F):5'- TGCACCCTTGTGACTGTA -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
Posted On 2015-01-23