Mutagenetix > Incidental Mutation

Incidental Mutation 'R2892:Gcfc2'

260125

Institutional Source

Beutler Lab

Gene Symbol

Gcfc2

Ensembl Gene

ENSMUSG00000035125

Gene Name

GC-rich sequence DNA binding factor 2

Synonyms

AW146020

MMRRC Submission

040480-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R2892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81923669-81959915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81956913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 717 (F717S)

Ref Sequence

ENSEMBL: ENSMUSP00000035644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]

AlphaFold

Q8BKT3

Predicted Effect

probably benign
Transcript: ENSMUST00000032124

SMART Domains

Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045

Domain	Start	End	E-Value	Type
low complexity region	60	74	N/A	INTRINSIC
Pfam:Ribosomal_L19	92	198	9e-19	PFAM
SCOP:d1fura_	214	282	2e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043195
AA Change: F717S

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: F717S

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC
coiled coil region	255	308	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
Pfam:GCFC	456	672	3e-34	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129678

Predicted Effect

probably benign
Transcript: ENSMUST00000152996

SMART Domains

Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203959

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,594,317	D232G	probably damaging	Het
Ank2	T	C	3: 127,248,243		probably null	Het
Atp6v0a4	T	C	6: 38,053,017	E704G	probably benign	Het
Bbx	A	G	16: 50,224,741	Y378H	probably damaging	Het
Carmil3	T	C	14: 55,498,313	V574A	probably damaging	Het
Cpz	A	G	5: 35,511,129	V379A	probably damaging	Het
Cyp4f15	A	G	17: 32,686,208	D55G	probably benign	Het
Dcun1d2	A	T	8: 13,278,649	I86N	probably damaging	Het
Defa30	A	T	8: 21,134,663	M1L	probably damaging	Het
Fzd8	G	T	18: 9,214,514	G532V	probably damaging	Het
Gckr	T	C	5: 31,326,472	V563A	probably benign	Het
Ighv1-24	T	G	12: 114,773,059	K74Q	probably benign	Het
Kcnj3	A	T	2: 55,447,015	I298F	probably damaging	Het
Miga2	A	T	2: 30,378,294		probably null	Het
Mmrn2	T	G	14: 34,396,630	F158V	probably benign	Het
Mug1	G	A	6: 121,840,070	V33M	possibly damaging	Het
Myom1	T	C	17: 71,034,653	S136P	probably damaging	Het
Nadk	A	G	4: 155,587,360	N232S	possibly damaging	Het
Olfr815	A	G	10: 129,901,940	Y257H	possibly damaging	Het
Olfr845	A	G	9: 19,338,738	T93A	probably benign	Het
Pcnx2	A	G	8: 125,891,058	S153P	probably damaging	Het
Pde8b	T	C	13: 95,034,259	D633G	probably damaging	Het
Pik3ap1	G	A	19: 41,376,061	A73V	probably benign	Het
Plrg1	C	A	3: 83,071,240	Q438K	probably damaging	Het
Plxna4	A	G	6: 32,517,037	Y215H	probably damaging	Het
Rapsn	A	T	2: 91,036,824	D157V	probably damaging	Het
Rock1	G	A	18: 10,072,863	Q1161*	probably null	Het
Snrnp200	T	C	2: 127,231,777	L1365P	probably damaging	Het
Srcap	T	C	7: 127,539,065	S1136P	probably damaging	Het
Trim80	A	G	11: 115,448,023	T560A	possibly damaging	Het
Ttll2	T	C	17: 7,352,699		probably null	Het
Usp8	A	T	2: 126,758,155	Q998L	probably damaging	Het
Vpreb3	C	T	10: 75,943,222		probably benign	Het
Zfp82	G	A	7: 30,056,439	T406I	probably damaging	Het

Other mutations in Gcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Gcfc2	APN	6	81936015	missense	probably damaging	0.99
IGL00473:Gcfc2	APN	6	81944374	missense	probably damaging	1.00
IGL00497:Gcfc2	APN	6	81957970	missense	probably benign	0.08
IGL02135:Gcfc2	APN	6	81941400	missense	probably damaging	1.00
R0138:Gcfc2	UTSW	6	81949954	missense	probably damaging	1.00
R0208:Gcfc2	UTSW	6	81943463	missense	probably null	0.91
R0467:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R1105:Gcfc2	UTSW	6	81939453	missense	probably damaging	1.00
R1521:Gcfc2	UTSW	6	81923812	missense	probably benign	0.14
R1602:Gcfc2	UTSW	6	81944420	missense	probably damaging	1.00
R1846:Gcfc2	UTSW	6	81956892	missense	probably damaging	0.99
R2091:Gcfc2	UTSW	6	81943479	missense	probably damaging	1.00
R2110:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2111:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2112:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R3792:Gcfc2	UTSW	6	81930767	missense	probably benign	0.00
R4284:Gcfc2	UTSW	6	81941391	missense	probably damaging	1.00
R4304:Gcfc2	UTSW	6	81943007	missense	probably damaging	1.00
R4691:Gcfc2	UTSW	6	81941427	nonsense	probably null
R5046:Gcfc2	UTSW	6	81948335	missense	probably benign	0.12
R5233:Gcfc2	UTSW	6	81953290	missense	probably damaging	1.00
R5307:Gcfc2	UTSW	6	81944386	missense	probably damaging	0.97
R5308:Gcfc2	UTSW	6	81943543	critical splice donor site	probably null
R5929:Gcfc2	UTSW	6	81946599	missense	probably damaging	1.00
R6339:Gcfc2	UTSW	6	81946496	missense	probably damaging	1.00
R6485:Gcfc2	UTSW	6	81939547	missense	probably damaging	1.00
R6931:Gcfc2	UTSW	6	81942985	missense	probably benign	0.36
R6948:Gcfc2	UTSW	6	81933753	missense	probably benign	0.01
R7392:Gcfc2	UTSW	6	81943012	critical splice donor site	probably null
R7423:Gcfc2	UTSW	6	81946560	missense	probably damaging	1.00
R7509:Gcfc2	UTSW	6	81953275	missense	probably damaging	1.00
R7713:Gcfc2	UTSW	6	81941390	missense	probably damaging	1.00
R8089:Gcfc2	UTSW	6	81925790	missense	probably damaging	1.00
R8249:Gcfc2	UTSW	6	81956951	missense	probably benign	0.02
R8366:Gcfc2	UTSW	6	81923801	missense	probably benign	0.05
R8553:Gcfc2	UTSW	6	81935963	missense	probably benign	0.01
R8560:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R8779:Gcfc2	UTSW	6	81948317	missense	probably benign	0.00
R8915:Gcfc2	UTSW	6	81941366	missense	probably benign	0.36
R8924:Gcfc2	UTSW	6	81932898	missense	probably damaging	1.00
R9687:Gcfc2	UTSW	6	81941342	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGTTACTTTTGATGCAGGG -3'
(R):5'- ACTATGCTGGCAGCTGATG -3'

Sequencing Primer
(F):5'- CAGGGAAGAAAAATCTCAAGCTTTC -3'
(R):5'- TTTAGATTGAACCCAGGGCC -3'

Posted On

2015-01-23