Incidental Mutation 'R2892:Gcfc2'
ID 260125
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene Name GC-rich sequence DNA binding factor 2
Synonyms AW146020
MMRRC Submission 040480-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.484) question?
Stock # R2892 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 81900650-81936896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81933894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 717 (F717S)
Ref Sequence ENSEMBL: ENSMUSP00000035644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]
AlphaFold Q8BKT3
Predicted Effect probably benign
Transcript: ENSMUST00000032124
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043195
AA Change: F717S

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: F717S

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129678
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203959
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,751,661 (GRCm39) D232G probably damaging Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,029,952 (GRCm39) E704G probably benign Het
Bbx A G 16: 50,045,104 (GRCm39) Y378H probably damaging Het
Carmil3 T C 14: 55,735,770 (GRCm39) V574A probably damaging Het
Cpz A G 5: 35,668,473 (GRCm39) V379A probably damaging Het
Cyp4f15 A G 17: 32,905,182 (GRCm39) D55G probably benign Het
Dcun1d2 A T 8: 13,328,649 (GRCm39) I86N probably damaging Het
Defa30 A T 8: 21,624,679 (GRCm39) M1L probably damaging Het
Fzd8 G T 18: 9,214,514 (GRCm39) G532V probably damaging Het
Gckr T C 5: 31,483,816 (GRCm39) V563A probably benign Het
Ighv1-24 T G 12: 114,736,679 (GRCm39) K74Q probably benign Het
Kcnj3 A T 2: 55,337,027 (GRCm39) I298F probably damaging Het
Miga2 A T 2: 30,268,306 (GRCm39) probably null Het
Mmrn2 T G 14: 34,118,587 (GRCm39) F158V probably benign Het
Mug1 G A 6: 121,817,029 (GRCm39) V33M possibly damaging Het
Myom1 T C 17: 71,341,648 (GRCm39) S136P probably damaging Het
Nadk A G 4: 155,671,817 (GRCm39) N232S possibly damaging Het
Or6c217 A G 10: 129,737,809 (GRCm39) Y257H possibly damaging Het
Or7g27 A G 9: 19,250,034 (GRCm39) T93A probably benign Het
Pcnx2 A G 8: 126,617,797 (GRCm39) S153P probably damaging Het
Pde8b T C 13: 95,170,767 (GRCm39) D633G probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Plrg1 C A 3: 82,978,547 (GRCm39) Q438K probably damaging Het
Plxna4 A G 6: 32,493,972 (GRCm39) Y215H probably damaging Het
Rapsn A T 2: 90,867,169 (GRCm39) D157V probably damaging Het
Rock1 G A 18: 10,072,863 (GRCm39) Q1161* probably null Het
Snrnp200 T C 2: 127,073,697 (GRCm39) L1365P probably damaging Het
Srcap T C 7: 127,138,237 (GRCm39) S1136P probably damaging Het
Trim80 A G 11: 115,338,849 (GRCm39) T560A possibly damaging Het
Ttll2 T C 17: 7,620,098 (GRCm39) probably null Het
Usp8 A T 2: 126,600,075 (GRCm39) Q998L probably damaging Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Zfp82 G A 7: 29,755,864 (GRCm39) T406I probably damaging Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81,912,996 (GRCm39) missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81,921,355 (GRCm39) missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81,934,951 (GRCm39) missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81,918,381 (GRCm39) missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81,926,935 (GRCm39) missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81,920,444 (GRCm39) missense probably null 0.91
R0467:Gcfc2 UTSW 6 81,900,863 (GRCm39) missense possibly damaging 0.56
R1105:Gcfc2 UTSW 6 81,916,434 (GRCm39) missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81,900,793 (GRCm39) missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81,921,401 (GRCm39) missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81,933,873 (GRCm39) missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81,920,460 (GRCm39) missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81,900,759 (GRCm39) missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81,900,759 (GRCm39) missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81,900,759 (GRCm39) missense probably benign 0.01
R3792:Gcfc2 UTSW 6 81,907,748 (GRCm39) missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81,918,372 (GRCm39) missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81,919,988 (GRCm39) missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81,918,408 (GRCm39) nonsense probably null
R5046:Gcfc2 UTSW 6 81,925,316 (GRCm39) missense probably benign 0.12
R5233:Gcfc2 UTSW 6 81,930,271 (GRCm39) missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81,921,367 (GRCm39) missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81,920,524 (GRCm39) critical splice donor site probably null
R5929:Gcfc2 UTSW 6 81,923,580 (GRCm39) missense probably damaging 1.00
R6339:Gcfc2 UTSW 6 81,923,477 (GRCm39) missense probably damaging 1.00
R6485:Gcfc2 UTSW 6 81,916,528 (GRCm39) missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81,919,966 (GRCm39) missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81,910,734 (GRCm39) missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81,919,993 (GRCm39) critical splice donor site probably null
R7423:Gcfc2 UTSW 6 81,923,541 (GRCm39) missense probably damaging 1.00
R7509:Gcfc2 UTSW 6 81,930,256 (GRCm39) missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81,918,371 (GRCm39) missense probably damaging 1.00
R8089:Gcfc2 UTSW 6 81,902,771 (GRCm39) missense probably damaging 1.00
R8249:Gcfc2 UTSW 6 81,933,932 (GRCm39) missense probably benign 0.02
R8366:Gcfc2 UTSW 6 81,900,782 (GRCm39) missense probably benign 0.05
R8553:Gcfc2 UTSW 6 81,912,944 (GRCm39) missense probably benign 0.01
R8560:Gcfc2 UTSW 6 81,900,863 (GRCm39) missense possibly damaging 0.56
R8779:Gcfc2 UTSW 6 81,925,298 (GRCm39) missense probably benign 0.00
R8915:Gcfc2 UTSW 6 81,918,347 (GRCm39) missense probably benign 0.36
R8924:Gcfc2 UTSW 6 81,909,879 (GRCm39) missense probably damaging 1.00
R9687:Gcfc2 UTSW 6 81,918,323 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTTACTTTTGATGCAGGG -3'
(R):5'- ACTATGCTGGCAGCTGATG -3'

Sequencing Primer
(F):5'- CAGGGAAGAAAAATCTCAAGCTTTC -3'
(R):5'- TTTAGATTGAACCCAGGGCC -3'
Posted On 2015-01-23