Incidental Mutation 'R2892:Olfr845'
ID260131
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission 040480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2892 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19338738 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 93 (T93A)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect probably benign
Transcript: ENSMUST00000071259
AA Change: T93A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: T93A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212246
AA Change: T93A
Predicted Effect probably benign
Transcript: ENSMUST00000213344
AA Change: T93A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215572
AA Change: T93A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Atp6v0a4 T C 6: 38,053,017 E704G probably benign Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pde8b T C 13: 95,034,259 D633G probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plrg1 C A 3: 83,071,240 Q438K probably damaging Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Trim80 A G 11: 115,448,023 T560A possibly damaging Het
Ttll2 T C 17: 7,352,699 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R0466:Olfr845 UTSW 9 19339179 missense probably damaging 1.00
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2082:Olfr845 UTSW 9 19339278 missense probably benign 0.36
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R3156:Olfr845 UTSW 9 19339424 unclassified probably null
R3943:Olfr845 UTSW 9 19339075 missense probably benign 0.05
R4116:Olfr845 UTSW 9 19338644 missense probably benign 0.39
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R6647:Olfr845 UTSW 9 19338629 missense possibly damaging 0.50
R7493:Olfr845 UTSW 9 19338813 missense probably damaging 0.98
R7522:Olfr845 UTSW 9 19338998 nonsense probably null
R7584:Olfr845 UTSW 9 19339273 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTACCTGGTCACATTTCTGGG -3'
(R):5'- TTCAGATGCAGCACCATGAG -3'

Sequencing Primer
(F):5'- GGAACCTAATTATAACCCTGACCATC -3'
(R):5'- GTAGTGCATTGACAGCACTAATAGCC -3'
Posted On2015-01-23