Incidental Mutation 'R2892:Ttll2'
ID 260142
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Name tubulin tyrosine ligase-like family, member 2
Synonyms EG625850
MMRRC Submission 040480-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R2892 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 7350885-7352696 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 7352699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
AlphaFold A4Q9E4
Predicted Effect probably null
Transcript: ENSMUST00000115747
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect silent
Transcript: ENSMUST00000231397
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Atp6v0a4 T C 6: 38,053,017 E704G probably benign Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Olfr845 A G 9: 19,338,738 T93A probably benign Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pde8b T C 13: 95,034,259 D633G probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plrg1 C A 3: 83,071,240 Q438K probably damaging Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Trim80 A G 11: 115,448,023 T560A possibly damaging Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7351731 missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7351380 missense probably benign 0.05
R1922:Ttll2 UTSW 17 7352390 missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7352123 missense probably benign 0.03
R4388:Ttll2 UTSW 17 7351200 nonsense probably null
R4389:Ttll2 UTSW 17 7351200 nonsense probably null
R4534:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4535:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4536:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4868:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4870:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4871:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R5990:Ttll2 UTSW 17 7352367 missense possibly damaging 0.95
R6145:Ttll2 UTSW 17 7351632 missense probably benign 0.08
R6332:Ttll2 UTSW 17 7351768 missense probably damaging 1.00
R7893:Ttll2 UTSW 17 7352091 missense probably benign 0.15
R8250:Ttll2 UTSW 17 7351368 missense probably benign 0.00
R8673:Ttll2 UTSW 17 7351941 missense possibly damaging 0.81
R9036:Ttll2 UTSW 17 7351655 missense probably benign 0.01
R9429:Ttll2 UTSW 17 7352686 missense probably damaging 1.00
R9455:Ttll2 UTSW 17 7352293 missense probably damaging 1.00
R9773:Ttll2 UTSW 17 7351277 missense probably benign 0.17
R9784:Ttll2 UTSW 17 7351308 missense probably benign 0.01
RF010:Ttll2 UTSW 17 7351338 missense probably benign 0.05
Z1088:Ttll2 UTSW 17 7351526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGGTGACATGGTTCCCTC -3'
(R):5'- CTGTATGCACACAGGCTATGC -3'

Sequencing Primer
(F):5'- GGTGACATGGTTCCCTCTCTCC -3'
(R):5'- CTCAGCAAGCTAAGTTGACTGGC -3'
Posted On 2015-01-23