Incidental Mutation 'R2878:Map3k19'
ID260150
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Namemitogen-activated protein kinase kinase kinase 19
SynonymsYsk4
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127815253-127855031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127823793 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 607 (E607V)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
Predicted Effect probably benign
Transcript: ENSMUST00000061512
AA Change: E403V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: E403V

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: E302V
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: E302V

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208183
AA Change: E607V

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0465:Map3k19 UTSW 1 127838527 missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127817425 missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127817254 missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127822248 nonsense probably null
R7702:Map3k19 UTSW 1 127829090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCCCATTCATTTCGGG -3'
(R):5'- GAAGACACTACTCCTACAGAGAGG -3'

Sequencing Primer
(F):5'- ACCCCATTCATTTCGGGATTTG -3'
(R):5'- CACTACTCCTACAGAGAGGGAAAG -3'
Posted On2015-01-23