Incidental Mutation 'R2878:F13b'
ID260151
Institutional Source Beutler Lab
Gene Symbol F13b
Ensembl Gene ENSMUSG00000026368
Gene Namecoagulation factor XIII, beta subunit
SynonymsCf-13b, Cf13b
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2878 (G1)
Quality Score199
Status Validated
Chromosome1
Chromosomal Location139501702-139523752 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 139501747 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000027615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027615]
Predicted Effect probably null
Transcript: ENSMUST00000027615
AA Change: M1T
SMART Domains Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 26 88 1.26e-7 SMART
CCP 92 147 2.11e-9 SMART
CCP 154 209 9.83e-10 SMART
CCP 214 268 7.62e-16 SMART
CCP 275 328 8.62e-15 SMART
CCP 337 390 4.62e-15 SMART
CCP 397 451 3.5e-15 SMART
Blast:CCP 455 516 1e-28 BLAST
CCP 525 579 2.44e-14 SMART
Blast:CCP 583 647 1e-8 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in F13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:F13b APN 1 139510587 missense probably benign 0.01
IGL00937:F13b APN 1 139517360 splice site probably benign
IGL01138:F13b APN 1 139517212 missense probably damaging 0.99
IGL01319:F13b APN 1 139506793 missense probably damaging 0.98
IGL01328:F13b APN 1 139508082 splice site probably benign
IGL01621:F13b APN 1 139503851 missense probably benign 0.00
IGL01843:F13b APN 1 139516427 missense probably damaging 1.00
IGL02153:F13b APN 1 139516377 missense probably damaging 1.00
IGL02192:F13b APN 1 139517333 missense probably damaging 1.00
IGL02555:F13b APN 1 139517186 missense probably damaging 1.00
IGL03036:F13b APN 1 139508115 missense possibly damaging 0.80
IGL03185:F13b APN 1 139516386 missense probably benign 0.03
IGL03303:F13b APN 1 139513036 missense possibly damaging 0.67
IGL03335:F13b APN 1 139522386 missense probably damaging 1.00
IGL03371:F13b APN 1 139506936 missense probably damaging 1.00
R0139:F13b UTSW 1 139508203 missense probably damaging 0.96
R0157:F13b UTSW 1 139503847 missense probably benign
R0381:F13b UTSW 1 139510859 missense probably damaging 0.98
R0492:F13b UTSW 1 139522559 splice site probably null
R0589:F13b UTSW 1 139506933 missense possibly damaging 0.94
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1515:F13b UTSW 1 139510965 missense probably damaging 1.00
R1869:F13b UTSW 1 139510934 missense probably benign 0.44
R2047:F13b UTSW 1 139508223 missense probably damaging 1.00
R2218:F13b UTSW 1 139506844 missense probably benign 0.42
R3032:F13b UTSW 1 139517333 missense probably damaging 1.00
R4077:F13b UTSW 1 139501770 missense unknown
R4079:F13b UTSW 1 139501770 missense unknown
R4208:F13b UTSW 1 139516341 missense probably damaging 1.00
R4350:F13b UTSW 1 139516298 missense probably benign 0.00
R4674:F13b UTSW 1 139501804 missense unknown
R4675:F13b UTSW 1 139501804 missense unknown
R4972:F13b UTSW 1 139510923 missense probably damaging 1.00
R5212:F13b UTSW 1 139512987 missense probably benign
R5343:F13b UTSW 1 139510544 missense possibly damaging 0.61
R5503:F13b UTSW 1 139522543 missense probably benign 0.00
R5984:F13b UTSW 1 139508212 missense probably damaging 1.00
R7012:F13b UTSW 1 139516358 missense probably benign
R7155:F13b UTSW 1 139508157 missense probably damaging 1.00
R7250:F13b UTSW 1 139516489 critical splice donor site probably null
R7478:F13b UTSW 1 139507695 missense probably benign 0.01
R7779:F13b UTSW 1 139516386 missense probably benign 0.03
R7960:F13b UTSW 1 139503771 nonsense probably null
R8007:F13b UTSW 1 139506942 missense probably benign 0.11
R8043:F13b UTSW 1 139522448 missense probably benign
R8281:F13b UTSW 1 139510951 missense probably benign 0.03
Z1088:F13b UTSW 1 139508202 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGCCTGTATTCATTATTTATGCTGC -3'
(R):5'- GCATTACAAAACTGGCATGTGAAAG -3'

Sequencing Primer
(F):5'- TCAGCTAATACTGGCACAATATTTTC -3'
(R):5'- GGCATGTGAAAGTGAAATATTAGGTC -3'
Posted On2015-01-23