Mutagenetix > Incidental Mutations

Incidental Mutation 'R2878:Shcbp1l'

260152

Institutional Source

Beutler Lab

Gene Symbol

Shcbp1l

Ensembl Gene

ENSMUSG00000042708

Gene Name

Shc SH2-domain binding protein 1-like

Synonyms

1700012A16Rik

MMRRC Submission

040466-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R2878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153425162-153452574 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 153437518 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137625 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042373] [ENSMUST00000136614]

Predicted Effect

probably benign
Transcript: ENSMUST00000042373

SMART Domains

Protein: ENSMUSP00000036347
Gene: ENSMUSG00000042708

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
CASH	362	522	2.85e-8	SMART
PbH1	479	500	2.3e3	SMART
PbH1	501	523	5.74e1	SMART
PbH1	524	557	2.3e3	SMART
PbH1	560	582	1.56e0	SMART
low complexity region	603	608	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082501

Predicted Effect

probably benign
Transcript: ENSMUST00000136614

SMART Domains

Protein: ENSMUSP00000137625
Gene: ENSMUSG00000042708

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (58/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Src homology 2 domain-binding protein 1-like protein. The encoded protein interacts with heat shock 70 kDa protein 2 and may be involved in maintaining spindle integrity during meiosis. This gene is located in region of chromoso0me 1 encompassing a prostate cancer susceptibility locus. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with reduced sperm, increased male germ cell apoptosis and spindle instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,291,889	L1251F	possibly damaging	Het
Accsl	A	T	2: 93,859,410	M384K	probably damaging	Het
Adgrg7	A	G	16: 56,750,454	F404L	probably benign	Het
Akr1c20	G	A	13: 4,507,775	T251M	probably damaging	Het
Amph	G	A	13: 19,104,267	V309I	possibly damaging	Het
Ano2	T	G	6: 125,863,518	F384C	probably damaging	Het
Aplf	G	A	6: 87,668,427	R32*	probably null	Het
Arhgef18	A	G	8: 3,432,759	M155V	probably benign	Het
Atg2b	A	T	12: 105,664,009	Y374*	probably null	Het
Camkmt	T	C	17: 85,431,551		probably benign	Het
Capn2	T	A	1: 182,517,233	E41V	probably benign	Het
Cd53	T	C	3: 106,767,416	T112A	probably benign	Het
Cyp2a4	G	A	7: 26,312,187	E278K	possibly damaging	Het
Dact2	A	T	17: 14,195,914	S675T	probably damaging	Het
Dync1li2	A	C	8: 104,429,415	Y265D	probably damaging	Het
Eml4	T	A	17: 83,410,174	H58Q	probably benign	Het
F13b	T	C	1: 139,501,747	M1T	probably null	Het
Fam83b	A	G	9: 76,490,810	F1004L	probably damaging	Het
Fbxo48	A	G	11: 16,953,382	K3E	possibly damaging	Het
Fbxw13	A	G	9: 109,181,466	F368S	probably damaging	Het
Fbxw19	A	T	9: 109,485,970	W175R	probably damaging	Het
Fibcd1	G	A	2: 31,838,666	P60S	probably benign	Het
Fscb	A	T	12: 64,472,574	V706E	unknown	Het
Gfm2	A	G	13: 97,153,249	R181G	possibly damaging	Het
Gm17546	A	T	15: 95,829,924		probably benign	Het
Gm4778	G	T	3: 94,266,480	C265F	possibly damaging	Het
Grin1	A	G	2: 25,297,629	V594A	probably damaging	Het
Itpripl1	A	G	2: 127,141,614	V196A	probably benign	Het
Kcns1	A	G	2: 164,164,762	I427T	probably damaging	Het
Map3k19	T	A	1: 127,823,793	E607V	possibly damaging	Het
Map3k4	T	C	17: 12,264,067	S588G	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nat6	A	T	9: 107,583,168	E87D	possibly damaging	Het
Nebl	C	A	2: 17,434,929	D178Y	probably damaging	Het
Nfatc3	C	A	8: 106,092,144	T498K	probably damaging	Het
Nfkb2	G	A	19: 46,307,441	R158H	possibly damaging	Het
Obscn	T	C	11: 59,056,188	E4337G	possibly damaging	Het
Olfr1459	A	G	19: 13,146,407	L84P	probably benign	Het
Palb2	A	G	7: 122,114,429	V877A	probably damaging	Het
Rbm6	T	C	9: 107,852,450	E333G	probably damaging	Het
Rem2	A	G	14: 54,476,362	T31A	possibly damaging	Het
Ric1	A	G	19: 29,602,330	D1224G	possibly damaging	Het
Rp1	A	G	1: 4,348,139	S917P	probably damaging	Het
Scn2a	G	A	2: 65,688,371	G363D	probably damaging	Het
Skor2	G	T	18: 76,860,724	E714*	probably null	Het
Slc15a1	T	A	14: 121,465,933	K545N	probably benign	Het
Slc1a2	T	A	2: 102,761,167	M414K	probably damaging	Het
Slc7a8	A	G	14: 54,759,686	S70P	probably damaging	Het
Taf1a	A	G	1: 183,397,835	E117G	probably damaging	Het
Trem2	A	G	17: 48,351,113	D135G	probably benign	Het
Ttn	T	C	2: 76,737,065	D27828G	probably damaging	Het
Ulk4	T	C	9: 121,260,039	D258G	probably benign	Het
Unc80	TGTATTCCAGGCG	TG	1: 66,671,576		probably benign	Het
Vmn2r56	A	C	7: 12,711,027	M433R	probably benign	Het
Wdr45	C	T	X: 7,727,372	P271S	probably damaging	Het
Zfp410	A	C	12: 84,331,637	N245T	probably damaging	Het

Other mutations in Shcbp1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Shcbp1l	APN	1	153435807	missense	possibly damaging	0.79
IGL01067:Shcbp1l	APN	1	153436024	missense	possibly damaging	0.49
IGL02292:Shcbp1l	APN	1	153436145	splice site	probably benign
IGL02588:Shcbp1l	APN	1	153428665	missense	probably benign	0.05
IGL03220:Shcbp1l	APN	1	153433165	splice site	probably benign
R0467:Shcbp1l	UTSW	1	153433182	missense	probably damaging	1.00
R0534:Shcbp1l	UTSW	1	153428568	missense	possibly damaging	0.78
R1192:Shcbp1l	UTSW	1	153425507	missense	possibly damaging	0.60
R2910:Shcbp1l	UTSW	1	153428626	missense	probably damaging	0.98
R2911:Shcbp1l	UTSW	1	153428626	missense	probably damaging	0.98
R3080:Shcbp1l	UTSW	1	153436037	missense	possibly damaging	0.95
R3854:Shcbp1l	UTSW	1	153452444	missense	probably damaging	1.00
R7373:Shcbp1l	UTSW	1	153425240	missense	probably benign	0.07
R7793:Shcbp1l	UTSW	1	153447825	missense	probably benign	0.00
Z1176:Shcbp1l	UTSW	1	153452274	missense	probably damaging	1.00
Z1176:Shcbp1l	UTSW	1	153452385	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGGCTACATGCAGATCTCTC -3'
(R):5'- CAGACAAGAATGCTCCATGGG -3'

Sequencing Primer
(F):5'- CTAGTCTACAAGTAGAGTTCCAGGC -3'
(R):5'- TCTCCCTCGGTGCCAGTG -3'

Posted On

2015-01-23