Incidental Mutation 'R2878:Nebl'
ID260155
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17434929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 178 (D178Y)
Ref Sequence ENSEMBL: ENSMUSP00000118525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124270
AA Change: D178Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: D178Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131957
AA Change: D178Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: D178Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132418
AA Change: D178Y

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: D178Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145492
AA Change: D178Y

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: D178Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145545
Meta Mutation Damage Score 0.6486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R7931:Nebl UTSW 2 17376622 critical splice donor site probably null
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8317:Nebl UTSW 2 17350757 missense possibly damaging 0.71
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8537:Nebl UTSW 2 17350709 missense probably benign 0.02
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCACTCAGGACAAAATTG -3'
(R):5'- ATCAGAGGAAATGAATGATCTGCAC -3'

Sequencing Primer
(F):5'- GTCACTCAGGACAAAATTGAGATGTC -3'
(R):5'- GAAAGTAACCTTAGTTCAGTGTGTTC -3'
Posted On2015-01-23