Incidental Mutation 'R2878:Slc1a2'
ID260162
Institutional Source Beutler Lab
Gene Symbol Slc1a2
Ensembl Gene ENSMUSG00000005089
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location102658659-102790784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102761167 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 414 (M414K)
Ref Sequence ENSEMBL: ENSMUSP00000106844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213]
Predicted Effect probably damaging
Transcript: ENSMUST00000005220
AA Change: M411K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089
AA Change: M411K

DomainStartEndE-ValueType
Pfam:SDF 43 492 8.9e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080210
AA Change: M414K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089
AA Change: M414K

DomainStartEndE-ValueType
Pfam:SDF 46 495 3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111212
AA Change: M411K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089
AA Change: M411K

DomainStartEndE-ValueType
Pfam:SDF 43 492 9.5e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111213
AA Change: M414K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089
AA Change: M414K

DomainStartEndE-ValueType
Pfam:SDF 46 495 2e-134 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136488
AA Change: M129K
SMART Domains Protein: ENSMUSP00000122094
Gene: ENSMUSG00000005089
AA Change: M129K

DomainStartEndE-ValueType
Pfam:SDF 1 144 2.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154446
SMART Domains Protein: ENSMUSP00000117549
Gene: ENSMUSG00000005089

DomainStartEndE-ValueType
Pfam:SDF 1 80 5.5e-28 PFAM
Meta Mutation Damage Score 0.7395 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Slc1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc1a2 APN 2 102777576 missense possibly damaging 0.55
IGL00588:Slc1a2 APN 2 102756001 missense probably benign
IGL00931:Slc1a2 APN 2 102756112 missense probably damaging 1.00
IGL00942:Slc1a2 APN 2 102739814 missense probably damaging 1.00
IGL02100:Slc1a2 APN 2 102756089 missense probably damaging 1.00
IGL02173:Slc1a2 APN 2 102743861 missense probably benign 0.05
IGL02184:Slc1a2 APN 2 102748544 missense probably damaging 1.00
IGL02480:Slc1a2 APN 2 102736066 missense probably damaging 1.00
IGL02643:Slc1a2 APN 2 102739880 missense probably benign 0.30
IGL03332:Slc1a2 APN 2 102748534 missense possibly damaging 0.96
R0335:Slc1a2 UTSW 2 102743863 missense probably benign
R0544:Slc1a2 UTSW 2 102756072 missense probably damaging 0.99
R0570:Slc1a2 UTSW 2 102756007 missense probably damaging 1.00
R1472:Slc1a2 UTSW 2 102737909 missense probably damaging 1.00
R1536:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R1856:Slc1a2 UTSW 2 102777567 missense probably damaging 0.97
R1936:Slc1a2 UTSW 2 102777605 missense probably benign 0.04
R1965:Slc1a2 UTSW 2 102739900 missense probably damaging 1.00
R2270:Slc1a2 UTSW 2 102735994 missense probably damaging 1.00
R2365:Slc1a2 UTSW 2 102748453 splice site probably null
R2567:Slc1a2 UTSW 2 102767010 missense probably damaging 1.00
R3080:Slc1a2 UTSW 2 102748556 missense probably damaging 1.00
R4716:Slc1a2 UTSW 2 102748538 missense probably damaging 0.96
R4744:Slc1a2 UTSW 2 102737869 missense probably benign 0.41
R5197:Slc1a2 UTSW 2 102756115 missense probably benign 0.02
R5835:Slc1a2 UTSW 2 102777450 missense probably damaging 1.00
R7077:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R7155:Slc1a2 UTSW 2 102766995 missense probably damaging 1.00
R7179:Slc1a2 UTSW 2 102755945 missense probably damaging 1.00
R7455:Slc1a2 UTSW 2 102735954 missense probably benign 0.16
R7492:Slc1a2 UTSW 2 102739930 nonsense probably null
R7818:Slc1a2 UTSW 2 102743956 missense probably benign 0.06
R7868:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
R8143:Slc1a2 UTSW 2 102737885 missense probably damaging 1.00
R8184:Slc1a2 UTSW 2 102737852 missense probably damaging 1.00
R8436:Slc1a2 UTSW 2 102755953 missense possibly damaging 0.65
R8508:Slc1a2 UTSW 2 102736085 critical splice donor site probably null
X0065:Slc1a2 UTSW 2 102737831 missense probably benign 0.12
Z1177:Slc1a2 UTSW 2 102761125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTTGCCTATCAGCAGC -3'
(R):5'- ACAACCTCCTCCCTTTGAAG -3'

Sequencing Primer
(F):5'- GTGTTGCCTATCAGCAGCTAAATTAG -3'
(R):5'- GAAGTCTGTCAGTAATTCCTTCACTG -3'
Posted On2015-01-23