Incidental Mutation 'R2878:Itpripl1'
ID260163
Institutional Source Beutler Lab
Gene Symbol Itpripl1
Ensembl Gene ENSMUSG00000074825
Gene Nameinositol 1,4,5-triphosphate receptor interacting protein-like 1
Synonyms
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127138772-127143442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127141614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000122289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110386] [ENSMUST00000132773] [ENSMUST00000154021]
Predicted Effect probably benign
Transcript: ENSMUST00000110386
AA Change: V196A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106016
Gene: ENSMUSG00000074825
AA Change: V196A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
coiled coil region 32 66 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
Mab-21 214 533 1.66e-66 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132773
AA Change: C114R
SMART Domains Protein: ENSMUSP00000118487
Gene: ENSMUSG00000074825
AA Change: C114R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
coiled coil region 32 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154021
AA Change: V196A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122289
Gene: ENSMUSG00000074825
AA Change: V196A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
coiled coil region 32 66 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
Mab-21 214 533 1.66e-66 SMART
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Itpripl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Itpripl1 APN 2 127141701 missense possibly damaging 0.87
IGL02978:Itpripl1 APN 2 127141012 missense probably damaging 1.00
R0328:Itpripl1 UTSW 2 127142004 missense possibly damaging 0.94
R0579:Itpripl1 UTSW 2 127141091 nonsense probably null
R1178:Itpripl1 UTSW 2 127141899 missense probably benign 0.05
R1623:Itpripl1 UTSW 2 127141635 missense possibly damaging 0.78
R1956:Itpripl1 UTSW 2 127142007 missense probably damaging 0.98
R2877:Itpripl1 UTSW 2 127141614 missense probably benign 0.00
R4949:Itpripl1 UTSW 2 127141407 missense probably benign 0.13
R5161:Itpripl1 UTSW 2 127141857 missense probably damaging 1.00
R5236:Itpripl1 UTSW 2 127141850 missense probably damaging 1.00
R5364:Itpripl1 UTSW 2 127141819 missense possibly damaging 0.60
R5637:Itpripl1 UTSW 2 127142124 missense probably damaging 1.00
R5715:Itpripl1 UTSW 2 127142007 missense probably damaging 0.98
R7545:Itpripl1 UTSW 2 127141661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACTCAGAGTCCACCTTC -3'
(R):5'- TCCTACGACAGAGCATGCAG -3'

Sequencing Primer
(F):5'- TCAGAGTCCACCTTCACACAG -3'
(R):5'- TTTGAGTCCAGCAGCGAG -3'
Posted On2015-01-23