Incidental Mutation 'R2878:Gm4778'
ID260166
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94266480 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 265 (C265F)
Ref Sequence ENSEMBL: ENSMUSP00000096477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098878
AA Change: C265F

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: C265F

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: C261F

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: C261F

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1284:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1383:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R5706:Gm4778 UTSW 3 94266652 missense possibly damaging 0.91
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R6928:Gm4778 UTSW 3 94266548 missense probably benign 0.31
R7091:Gm4778 UTSW 3 94266638 missense probably damaging 1.00
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
R7503:Gm4778 UTSW 3 94266473 missense probably benign 0.29
R7595:Gm4778 UTSW 3 94266678 missense probably benign 0.00
R7867:Gm4778 UTSW 3 94265847 missense probably benign 0.25
R8338:Gm4778 UTSW 3 94265978 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATTCCCTGTGCACAGACTGC -3'
(R):5'- AGTGCAATGAAATCCAGGGCC -3'

Sequencing Primer
(F):5'- ACAGACTGCTGCCTGTTG -3'
(R):5'- ATGAAATCCAGGGCCTGAGTCTTC -3'
Posted On2015-01-23