Incidental Mutation 'R2878:Cd53'
ID260167
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene NameCD53 antigen
SynonymsTspan25, Ox-44
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location106759921-106790149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106767416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
Predicted Effect probably benign
Transcript: ENSMUST00000038845
AA Change: T112A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106768826 missense probably damaging 1.00
IGL02592:Cd53 APN 3 106763285 missense probably damaging 1.00
R0090:Cd53 UTSW 3 106767409 missense possibly damaging 0.94
R0392:Cd53 UTSW 3 106763276 missense probably damaging 1.00
R0538:Cd53 UTSW 3 106762128 missense probably benign 0.07
R1452:Cd53 UTSW 3 106768959 missense probably damaging 1.00
R1693:Cd53 UTSW 3 106768889 missense possibly damaging 0.66
R2042:Cd53 UTSW 3 106767424 critical splice acceptor site probably null
R2300:Cd53 UTSW 3 106763256 missense probably benign
R4081:Cd53 UTSW 3 106762145 missense probably benign
R6180:Cd53 UTSW 3 106767364 missense probably damaging 0.96
R6519:Cd53 UTSW 3 106762145 missense probably benign 0.00
R6694:Cd53 UTSW 3 106767386 missense probably benign 0.03
R7043:Cd53 UTSW 3 106763261 missense probably damaging 1.00
R7417:Cd53 UTSW 3 106768919 missense probably benign 0.17
R7736:Cd53 UTSW 3 106767936 missense probably benign 0.12
R7893:Cd53 UTSW 3 106767386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGCCTCTGAGAGCAAAGACATTC -3'
(R):5'- TAGATCCCACATAATCCTCAGCTTC -3'

Sequencing Primer
(F):5'- CTTAGAGTCTGAAACCTTTAGGAAAG -3'
(R):5'- CCACATAATCCTCAGCTTCTCTTC -3'
Posted On2015-01-23