Incidental Mutation 'R2878:Ano2'
List |< first << previous [record 6 of 57] next >> last >|
ID260169
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Nameanoctamin 2
SynonymsTmem16b
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125690419-126040126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125863518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 384 (F384C)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159984] [ENSMUST00000160496]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159111
Predicted Effect probably damaging
Transcript: ENSMUST00000159984
AA Change: F54C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123965
Gene: ENSMUSG00000038115
AA Change: F54C

DomainStartEndE-ValueType
Pfam:Anoctamin 21 181 1.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160317
Predicted Effect probably damaging
Transcript: ENSMUST00000160496
AA Change: F384C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: F384C

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161619
AA Change: F353C
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115
AA Change: F353C

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Meta Mutation Damage Score 0.2241 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 126013253 missense probably damaging 1.00
IGL01387:Ano2 APN 6 126013277 missense probably damaging 0.99
IGL01772:Ano2 APN 6 126036858 missense probably damaging 0.98
IGL01931:Ano2 APN 6 125982745 missense probably damaging 1.00
IGL02066:Ano2 APN 6 125690739 missense probably benign 0.07
IGL02410:Ano2 APN 6 125815533 critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125872751 critical splice donor site probably null
IGL03116:Ano2 APN 6 125980171 nonsense probably null
IGL03183:Ano2 APN 6 125710629 missense probably benign
IGL03391:Ano2 APN 6 125807839 missense probably damaging 1.00
R0257:Ano2 UTSW 6 125880713 missense probably benign 0.05
R0462:Ano2 UTSW 6 125712275 missense probably benign 0.26
R0594:Ano2 UTSW 6 125982765 missense probably damaging 1.00
R1072:Ano2 UTSW 6 126039324 missense probably damaging 1.00
R1099:Ano2 UTSW 6 125807847 missense probably damaging 1.00
R1436:Ano2 UTSW 6 125867171 critical splice donor site probably null
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1822:Ano2 UTSW 6 125863457 missense probably damaging 1.00
R1901:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1902:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1911:Ano2 UTSW 6 126013691 missense probably benign 0.00
R2040:Ano2 UTSW 6 126039508 missense probably benign 0.13
R2192:Ano2 UTSW 6 126015539 missense probably damaging 1.00
R2307:Ano2 UTSW 6 125992886 missense probably benign 0.00
R2698:Ano2 UTSW 6 125712346 missense probably benign 0.01
R3151:Ano2 UTSW 6 126013317 splice site probably null
R4004:Ano2 UTSW 6 126013279 missense probably damaging 1.00
R4664:Ano2 UTSW 6 125863538 missense probably benign 0.07
R4684:Ano2 UTSW 6 125790341 missense probably benign 0.00
R4685:Ano2 UTSW 6 125980124 nonsense probably null
R4686:Ano2 UTSW 6 125790291 missense probably benign 0.10
R4852:Ano2 UTSW 6 125982923 missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125903055 utr 3 prime probably benign
R5488:Ano2 UTSW 6 126039253 missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126039322 missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125872740 missense probably damaging 1.00
R5876:Ano2 UTSW 6 126039279 missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125992955 missense probably benign 0.15
R6219:Ano2 UTSW 6 125815590 missense probably damaging 1.00
R6613:Ano2 UTSW 6 125806656 splice site probably null
R6711:Ano2 UTSW 6 125775832 missense probably damaging 1.00
R6982:Ano2 UTSW 6 125992893 missense probably benign
R7153:Ano2 UTSW 6 125992943 missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125790293 missense probably damaging 0.99
R7312:Ano2 UTSW 6 126039497 nonsense probably null
R7358:Ano2 UTSW 6 125710733 missense probably benign
R7456:Ano2 UTSW 6 125963545 missense probably benign 0.01
R7532:Ano2 UTSW 6 125963704 missense probably damaging 1.00
R7607:Ano2 UTSW 6 125712419 missense probably damaging 1.00
R7623:Ano2 UTSW 6 126015573 nonsense probably null
R7690:Ano2 UTSW 6 126013198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTCCCTTCTCCTGTAG -3'
(R):5'- AGCTCCCAGATCCAACTCTG -3'

Sequencing Primer
(F):5'- CCCTTTGAATTCATGACAAGAGTG -3'
(R):5'- CCAACTCTGGAGAGAAGTTACATGTG -3'
Posted On2015-01-23