Mutagenetix > Incidental Mutation

Incidental Mutation 'R2878:Nfatc3'

260175

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

MMRRC Submission

040466-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 106092144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 498 (T498K)

Ref Sequence

ENSEMBL: ENSMUSP00000148556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109308
AA Change: T506K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: T506K

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211991
AA Change: T498K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212577

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212691

Predicted Effect

probably damaging
Transcript: ENSMUST00000212742
AA Change: T498K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212936

Meta Mutation Damage Score

0.6647

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (58/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,291,889	L1251F	possibly damaging	Het
Accsl	A	T	2: 93,859,410	M384K	probably damaging	Het
Adgrg7	A	G	16: 56,750,454	F404L	probably benign	Het
Akr1c20	G	A	13: 4,507,775	T251M	probably damaging	Het
Amph	G	A	13: 19,104,267	V309I	possibly damaging	Het
Ano2	T	G	6: 125,863,518	F384C	probably damaging	Het
Aplf	G	A	6: 87,668,427	R32*	probably null	Het
Arhgef18	A	G	8: 3,432,759	M155V	probably benign	Het
Atg2b	A	T	12: 105,664,009	Y374*	probably null	Het
Camkmt	T	C	17: 85,431,551		probably benign	Het
Capn2	T	A	1: 182,517,233	E41V	probably benign	Het
Cd53	T	C	3: 106,767,416	T112A	probably benign	Het
Cyp2a4	G	A	7: 26,312,187	E278K	possibly damaging	Het
Dact2	A	T	17: 14,195,914	S675T	probably damaging	Het
Dync1li2	A	C	8: 104,429,415	Y265D	probably damaging	Het
Eml4	T	A	17: 83,410,174	H58Q	probably benign	Het
F13b	T	C	1: 139,501,747	M1T	probably null	Het
Fam83b	A	G	9: 76,490,810	F1004L	probably damaging	Het
Fbxo48	A	G	11: 16,953,382	K3E	possibly damaging	Het
Fbxw13	A	G	9: 109,181,466	F368S	probably damaging	Het
Fbxw19	A	T	9: 109,485,970	W175R	probably damaging	Het
Fibcd1	G	A	2: 31,838,666	P60S	probably benign	Het
Fscb	A	T	12: 64,472,574	V706E	unknown	Het
Gfm2	A	G	13: 97,153,249	R181G	possibly damaging	Het
Gm17546	A	T	15: 95,829,924		probably benign	Het
Gm4778	G	T	3: 94,266,480	C265F	possibly damaging	Het
Grin1	A	G	2: 25,297,629	V594A	probably damaging	Het
Itpripl1	A	G	2: 127,141,614	V196A	probably benign	Het
Kcns1	A	G	2: 164,164,762	I427T	probably damaging	Het
Map3k19	T	A	1: 127,823,793	E607V	possibly damaging	Het
Map3k4	T	C	17: 12,264,067	S588G	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nat6	A	T	9: 107,583,168	E87D	possibly damaging	Het
Nebl	C	A	2: 17,434,929	D178Y	probably damaging	Het
Nfkb2	G	A	19: 46,307,441	R158H	possibly damaging	Het
Obscn	T	C	11: 59,056,188	E4337G	possibly damaging	Het
Olfr1459	A	G	19: 13,146,407	L84P	probably benign	Het
Palb2	A	G	7: 122,114,429	V877A	probably damaging	Het
Rbm6	T	C	9: 107,852,450	E333G	probably damaging	Het
Rem2	A	G	14: 54,476,362	T31A	possibly damaging	Het
Ric1	A	G	19: 29,602,330	D1224G	possibly damaging	Het
Rp1	A	G	1: 4,348,139	S917P	probably damaging	Het
Scn2a	G	A	2: 65,688,371	G363D	probably damaging	Het
Shcbp1l	A	T	1: 153,437,518		probably benign	Het
Skor2	G	T	18: 76,860,724	E714*	probably null	Het
Slc15a1	T	A	14: 121,465,933	K545N	probably benign	Het
Slc1a2	T	A	2: 102,761,167	M414K	probably damaging	Het
Slc7a8	A	G	14: 54,759,686	S70P	probably damaging	Het
Taf1a	A	G	1: 183,397,835	E117G	probably damaging	Het
Trem2	A	G	17: 48,351,113	D135G	probably benign	Het
Ttn	T	C	2: 76,737,065	D27828G	probably damaging	Het
Ulk4	T	C	9: 121,260,039	D258G	probably benign	Het
Unc80	TGTATTCCAGGCG	TG	1: 66,671,576		probably benign	Het
Vmn2r56	A	C	7: 12,711,027	M433R	probably benign	Het
Wdr45	C	T	X: 7,727,372	P271S	probably damaging	Het
Zfp410	A	C	12: 84,331,637	N245T	probably damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Kampf	UTSW	8	106099150	missense	probably benign	0.23
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1509:Nfatc3	UTSW	8	106083854	missense	possibly damaging	0.46
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2370:Nfatc3	UTSW	8	106108455	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5741:Nfatc3	UTSW	8	106079066	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R6925:Nfatc3	UTSW	8	106119322	missense	probably benign	0.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7526:Nfatc3	UTSW	8	106079083	missense	probably damaging	1.00
R7760:Nfatc3	UTSW	8	106108341	missense	possibly damaging	0.66
R8783:Nfatc3	UTSW	8	106099152	missense	possibly damaging	0.63
R8867:Nfatc3	UTSW	8	106079008	missense	probably damaging	1.00
R8978:Nfatc3	UTSW	8	106108770	missense	probably benign	0.03
R9021:Nfatc3	UTSW	8	106092113	missense	probably damaging	1.00
R9066:Nfatc3	UTSW	8	106099150	missense	probably benign	0.23
R9538:Nfatc3	UTSW	8	106108152	missense	probably benign	0.35
R9656:Nfatc3	UTSW	8	106104134	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04
Z1177:Nfatc3	UTSW	8	106092066	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTCACGGGTTACTTTACTG -3'
(R):5'- AGCAAAGGTTTTAAGTTAGCTGGC -3'

Sequencing Primer
(F):5'- CACGGGTTACTTTACTGTCTGTTTTG -3'
(R):5'- TCTACAGAGTGAGTTCTAGGACAGCC -3'

Posted On

2015-01-23