Incidental Mutation 'R2878:Nfatc3'
ID 260175
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Synonyms NFATx, D8Ertd281e, NFAT4
MMRRC Submission 040466-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2878 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106785472-106857169 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106818776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 498 (T498K)
Ref Sequence ENSEMBL: ENSMUSP00000148556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109308
AA Change: T506K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: T506K

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211991
AA Change: T498K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212691
Predicted Effect probably damaging
Transcript: ENSMUST00000212742
AA Change: T498K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212936
Meta Mutation Damage Score 0.6647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,241,889 (GRCm39) L1251F possibly damaging Het
Accsl A T 2: 93,689,755 (GRCm39) M384K probably damaging Het
Adgrg7 A G 16: 56,570,817 (GRCm39) F404L probably benign Het
Akr1c20 G A 13: 4,557,774 (GRCm39) T251M probably damaging Het
Amph G A 13: 19,288,437 (GRCm39) V309I possibly damaging Het
Ano2 T G 6: 125,840,481 (GRCm39) F384C probably damaging Het
Aplf G A 6: 87,645,409 (GRCm39) R32* probably null Het
Arhgef18 A G 8: 3,482,759 (GRCm39) M155V probably benign Het
Atg2b A T 12: 105,630,268 (GRCm39) Y374* probably null Het
Camkmt T C 17: 85,738,979 (GRCm39) probably benign Het
Capn2 T A 1: 182,344,798 (GRCm39) E41V probably benign Het
Cd53 T C 3: 106,674,732 (GRCm39) T112A probably benign Het
Cyp2a4 G A 7: 26,011,612 (GRCm39) E278K possibly damaging Het
Dact2 A T 17: 14,416,176 (GRCm39) S675T probably damaging Het
Dync1li2 A C 8: 105,156,047 (GRCm39) Y265D probably damaging Het
Eml4 T A 17: 83,717,603 (GRCm39) H58Q probably benign Het
F13b T C 1: 139,429,485 (GRCm39) M1T probably null Het
Fam83b A G 9: 76,398,092 (GRCm39) F1004L probably damaging Het
Fbxo48 A G 11: 16,903,382 (GRCm39) K3E possibly damaging Het
Fbxw13 A G 9: 109,010,534 (GRCm39) F368S probably damaging Het
Fbxw19 A T 9: 109,315,038 (GRCm39) W175R probably damaging Het
Fibcd1 G A 2: 31,728,678 (GRCm39) P60S probably benign Het
Fscb A T 12: 64,519,348 (GRCm39) V706E unknown Het
Gfm2 A G 13: 97,289,757 (GRCm39) R181G possibly damaging Het
Gm17546 A T 15: 95,727,805 (GRCm39) probably benign Het
Grin1 A G 2: 25,187,641 (GRCm39) V594A probably damaging Het
Itpripl1 A G 2: 126,983,534 (GRCm39) V196A probably benign Het
Kcns1 A G 2: 164,006,682 (GRCm39) I427T probably damaging Het
Map3k19 T A 1: 127,751,530 (GRCm39) E607V possibly damaging Het
Map3k4 T C 17: 12,482,954 (GRCm39) S588G probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Naa80 A T 9: 107,460,367 (GRCm39) E87D possibly damaging Het
Nebl C A 2: 17,439,740 (GRCm39) D178Y probably damaging Het
Nfkb2 G A 19: 46,295,880 (GRCm39) R158H possibly damaging Het
Obscn T C 11: 58,947,014 (GRCm39) E4337G possibly damaging Het
Or5b106 A G 19: 13,123,771 (GRCm39) L84P probably benign Het
Palb2 A G 7: 121,713,652 (GRCm39) V877A probably damaging Het
Rbm6 T C 9: 107,729,649 (GRCm39) E333G probably damaging Het
Rem2 A G 14: 54,713,819 (GRCm39) T31A possibly damaging Het
Ric1 A G 19: 29,579,730 (GRCm39) D1224G possibly damaging Het
Rp1 A G 1: 4,418,362 (GRCm39) S917P probably damaging Het
Scn2a G A 2: 65,518,715 (GRCm39) G363D probably damaging Het
Shcbp1l A T 1: 153,313,264 (GRCm39) probably benign Het
Skor2 G T 18: 76,948,419 (GRCm39) E714* probably null Het
Slc15a1 T A 14: 121,703,345 (GRCm39) K545N probably benign Het
Slc1a2 T A 2: 102,591,512 (GRCm39) M414K probably damaging Het
Slc7a8 A G 14: 54,997,143 (GRCm39) S70P probably damaging Het
Spopfm1 G T 3: 94,173,787 (GRCm39) C265F possibly damaging Het
Taf1a A G 1: 183,179,173 (GRCm39) E117G probably damaging Het
Trem2 A G 17: 48,658,141 (GRCm39) D135G probably benign Het
Ttn T C 2: 76,567,409 (GRCm39) D27828G probably damaging Het
Ulk4 T C 9: 121,089,105 (GRCm39) D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,710,735 (GRCm39) probably benign Het
Vmn2r56 A C 7: 12,444,954 (GRCm39) M433R probably benign Het
Wdr45 C T X: 7,593,611 (GRCm39) P271S probably damaging Het
Zfp410 A C 12: 84,378,411 (GRCm39) N245T probably damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106,825,809 (GRCm39) missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106,854,553 (GRCm39) missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106,805,532 (GRCm39) missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106,834,817 (GRCm39) missense probably benign 0.29
Kampf UTSW 8 106,825,782 (GRCm39) missense probably benign 0.23
Struggles UTSW 8 106,810,502 (GRCm39) nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106,786,605 (GRCm39) missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106,805,835 (GRCm39) missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106,854,574 (GRCm39) missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106,818,827 (GRCm39) missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106,822,828 (GRCm39) missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106,810,486 (GRCm39) missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106,818,792 (GRCm39) missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106,810,466 (GRCm39) missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106,805,482 (GRCm39) missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106,825,768 (GRCm39) missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106,835,087 (GRCm39) missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106,806,277 (GRCm39) missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106,825,709 (GRCm39) nonsense probably null
R4006:Nfatc3 UTSW 8 106,835,471 (GRCm39) missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106,806,123 (GRCm39) missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106,805,705 (GRCm39) missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106,835,011 (GRCm39) missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106,806,359 (GRCm39) missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106,834,757 (GRCm39) missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106,805,689 (GRCm39) missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106,805,698 (GRCm39) missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106,822,944 (GRCm39) missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106,810,502 (GRCm39) nonsense probably null
R6557:Nfatc3 UTSW 8 106,845,986 (GRCm39) missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106,810,601 (GRCm39) missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106,845,954 (GRCm39) missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106,835,578 (GRCm39) missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106,835,035 (GRCm39) missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106,835,035 (GRCm39) missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106,805,715 (GRCm39) missense probably damaging 1.00
R7760:Nfatc3 UTSW 8 106,834,973 (GRCm39) missense possibly damaging 0.66
R8783:Nfatc3 UTSW 8 106,825,784 (GRCm39) missense possibly damaging 0.63
R8867:Nfatc3 UTSW 8 106,805,640 (GRCm39) missense probably damaging 1.00
R8978:Nfatc3 UTSW 8 106,835,402 (GRCm39) missense probably benign 0.03
R9021:Nfatc3 UTSW 8 106,818,745 (GRCm39) missense probably damaging 1.00
R9066:Nfatc3 UTSW 8 106,825,782 (GRCm39) missense probably benign 0.23
R9538:Nfatc3 UTSW 8 106,834,784 (GRCm39) missense probably benign 0.35
R9656:Nfatc3 UTSW 8 106,830,766 (GRCm39) missense probably damaging 1.00
X0063:Nfatc3 UTSW 8 106,810,571 (GRCm39) missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106,834,981 (GRCm39) missense probably benign 0.04
Z1177:Nfatc3 UTSW 8 106,818,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCACGGGTTACTTTACTG -3'
(R):5'- AGCAAAGGTTTTAAGTTAGCTGGC -3'

Sequencing Primer
(F):5'- CACGGGTTACTTTACTGTCTGTTTTG -3'
(R):5'- TCTACAGAGTGAGTTCTAGGACAGCC -3'
Posted On 2015-01-23