Incidental Mutation 'R2878:Fbxw13'
ID260179
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene NameF-box and WD-40 domain protein 13
Synonyms
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109179227-109195975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109181466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 368 (F368S)
Ref Sequence ENSEMBL: ENSMUSP00000053786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199118]
Predicted Effect probably damaging
Transcript: ENSMUST00000061456
AA Change: F368S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314
AA Change: F368S

DomainStartEndE-ValueType
FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199102
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 3.25e-4 SMART
Meta Mutation Damage Score 0.8129 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109181416 missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109183187 missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109181465 missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109194721 missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109185371 missense probably damaging 1.00
R1710:Fbxw13 UTSW 9 109181518 missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109181543 missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R3085:Fbxw13 UTSW 9 109184231 nonsense probably null
R4321:Fbxw13 UTSW 9 109181435 missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109181524 splice site probably null
R5024:Fbxw13 UTSW 9 109179335 missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109184157 missense probably benign 0.41
R5957:Fbxw13 UTSW 9 109192666 critical splice donor site probably null
R6801:Fbxw13 UTSW 9 109194727 missense probably null 1.00
R7448:Fbxw13 UTSW 9 109185403 missense unknown
R7710:Fbxw13 UTSW 9 109195900 missense probably damaging 1.00
R8163:Fbxw13 UTSW 9 109183054 missense probably benign 0.45
R8320:Fbxw13 UTSW 9 109183066 missense probably benign 0.02
X0065:Fbxw13 UTSW 9 109192708 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGAGTAGGCTGGAGTCAATATC -3'
(R):5'- CCATGGAAGGAGCGATATGC -3'

Sequencing Primer
(F):5'- AATTCCAGGAAGTTGGCCTC -3'
(R):5'- TCAGTAAGCATTAAGGATATTGCTC -3'
Posted On2015-01-23