Mutagenetix > Incidental Mutations

Incidental Mutation 'R2878:Slc15a1'

260195

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

040466-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R2878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121465933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 545 (K545N)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably benign
Transcript: ENSMUST00000088386
AA Change: K545N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: K545N

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227372

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (58/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,291,889	L1251F	possibly damaging	Het
Accsl	A	T	2: 93,859,410	M384K	probably damaging	Het
Adgrg7	A	G	16: 56,750,454	F404L	probably benign	Het
Akr1c20	G	A	13: 4,507,775	T251M	probably damaging	Het
Amph	G	A	13: 19,104,267	V309I	possibly damaging	Het
Ano2	T	G	6: 125,863,518	F384C	probably damaging	Het
Aplf	G	A	6: 87,668,427	R32*	probably null	Het
Arhgef18	A	G	8: 3,432,759	M155V	probably benign	Het
Atg2b	A	T	12: 105,664,009	Y374*	probably null	Het
Camkmt	T	C	17: 85,431,551		probably benign	Het
Capn2	T	A	1: 182,517,233	E41V	probably benign	Het
Cd53	T	C	3: 106,767,416	T112A	probably benign	Het
Cyp2a4	G	A	7: 26,312,187	E278K	possibly damaging	Het
Dact2	A	T	17: 14,195,914	S675T	probably damaging	Het
Dync1li2	A	C	8: 104,429,415	Y265D	probably damaging	Het
Eml4	T	A	17: 83,410,174	H58Q	probably benign	Het
F13b	T	C	1: 139,501,747	M1T	probably null	Het
Fam83b	A	G	9: 76,490,810	F1004L	probably damaging	Het
Fbxo48	A	G	11: 16,953,382	K3E	possibly damaging	Het
Fbxw13	A	G	9: 109,181,466	F368S	probably damaging	Het
Fbxw19	A	T	9: 109,485,970	W175R	probably damaging	Het
Fibcd1	G	A	2: 31,838,666	P60S	probably benign	Het
Fscb	A	T	12: 64,472,574	V706E	unknown	Het
Gfm2	A	G	13: 97,153,249	R181G	possibly damaging	Het
Gm17546	A	T	15: 95,829,924		probably benign	Het
Gm4778	G	T	3: 94,266,480	C265F	possibly damaging	Het
Grin1	A	G	2: 25,297,629	V594A	probably damaging	Het
Itpripl1	A	G	2: 127,141,614	V196A	probably benign	Het
Kcns1	A	G	2: 164,164,762	I427T	probably damaging	Het
Map3k19	T	A	1: 127,823,793	E607V	possibly damaging	Het
Map3k4	T	C	17: 12,264,067	S588G	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nat6	A	T	9: 107,583,168	E87D	possibly damaging	Het
Nebl	C	A	2: 17,434,929	D178Y	probably damaging	Het
Nfatc3	C	A	8: 106,092,144	T498K	probably damaging	Het
Nfkb2	G	A	19: 46,307,441	R158H	possibly damaging	Het
Obscn	T	C	11: 59,056,188	E4337G	possibly damaging	Het
Olfr1459	A	G	19: 13,146,407	L84P	probably benign	Het
Palb2	A	G	7: 122,114,429	V877A	probably damaging	Het
Rbm6	T	C	9: 107,852,450	E333G	probably damaging	Het
Rem2	A	G	14: 54,476,362	T31A	possibly damaging	Het
Ric1	A	G	19: 29,602,330	D1224G	possibly damaging	Het
Rp1	A	G	1: 4,348,139	S917P	probably damaging	Het
Scn2a	G	A	2: 65,688,371	G363D	probably damaging	Het
Shcbp1l	A	T	1: 153,437,518		probably benign	Het
Skor2	G	T	18: 76,860,724	E714*	probably null	Het
Slc1a2	T	A	2: 102,761,167	M414K	probably damaging	Het
Slc7a8	A	G	14: 54,759,686	S70P	probably damaging	Het
Taf1a	A	G	1: 183,397,835	E117G	probably damaging	Het
Trem2	A	G	17: 48,351,113	D135G	probably benign	Het
Ttn	T	C	2: 76,737,065	D27828G	probably damaging	Het
Ulk4	T	C	9: 121,260,039	D258G	probably benign	Het
Unc80	TGTATTCCAGGCG	TG	1: 66,671,576		probably benign	Het
Vmn2r56	A	C	7: 12,711,027	M433R	probably benign	Het
Wdr45	C	T	X: 7,727,372	P271S	probably damaging	Het
Zfp410	A	C	12: 84,331,637	N245T	probably damaging	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTGGGTTAGTTCTAAGACCATC -3'
(R):5'- ACCCTTAACGAGATGGTCACC -3'

Sequencing Primer
(F):5'- GGGTTAGTTCTAAGACCATCTACAG -3'
(R):5'- AGTGAGTACCTTTACTGGGCAAC -3'

Posted On

2015-01-23