Incidental Mutation 'R2878:Olfr1459'
ID260206
Institutional Source Beutler Lab
Gene Symbol Olfr1459
Ensembl Gene ENSMUSG00000057503
Gene Nameolfactory receptor 1459
SynonymsMOR202-17, GA_x6K02T2RE5P-3473421-3472498
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13138021-13149549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13146407 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000150886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078299] [ENSMUST00000213493]
Predicted Effect probably benign
Transcript: ENSMUST00000078299
AA Change: L84P

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077414
Gene: ENSMUSG00000057503
AA Change: L84P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8e-50 PFAM
Pfam:7tm_1 39 288 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213493
AA Change: L84P

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215405
Meta Mutation Damage Score 0.6369 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Olfr1459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1459 APN 19 13145828 missense possibly damaging 0.82
IGL01618:Olfr1459 APN 19 13146250 missense probably benign 0.00
IGL01800:Olfr1459 APN 19 13146629 missense probably damaging 1.00
IGL02224:Olfr1459 APN 19 13145756 missense probably damaging 1.00
BB009:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
BB019:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
PIT4651001:Olfr1459 UTSW 19 13146627 missense probably benign 0.02
R0617:Olfr1459 UTSW 19 13146363 missense probably benign 0.28
R2041:Olfr1459 UTSW 19 13146677 start gained probably benign
R3742:Olfr1459 UTSW 19 13145894 missense probably damaging 0.98
R4905:Olfr1459 UTSW 19 13146177 missense probably benign 0.07
R4914:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4915:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4916:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4917:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4918:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R5367:Olfr1459 UTSW 19 13146501 missense probably damaging 0.98
R6242:Olfr1459 UTSW 19 13146086 missense probably benign 0.05
R6632:Olfr1459 UTSW 19 13146188 missense probably benign 0.02
R6893:Olfr1459 UTSW 19 13145742 missense probably benign 0.00
R7932:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGAAGGAGAGACTTAATGCATCC -3'
(R):5'- GACTCACAACTGCAGCTTCC -3'

Sequencing Primer
(F):5'- CCATAGTATAGATGGAAGCATTCAGC -3'
(R):5'- ACAACTGCAGCTTCCCCTCTTC -3'
Posted On2015-01-23