Incidental Mutation 'R2879:Tmem131'
ID260210
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Nametransmembrane protein 131
Synonyms2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission 040467-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R2879 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36792191-36943666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36841707 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 161 (I161V)
Ref Sequence ENSEMBL: ENSMUSP00000142307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000185964] [ENSMUST00000194563]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027290
AA Change: I161V

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116
AA Change: I161V

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185964
AA Change: I50V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect possibly damaging
Transcript: ENSMUST00000194563
AA Change: I161V

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116
AA Change: I161V

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Akap9 A G 5: 3,976,353 probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Arhgef10l G T 4: 140,515,287 H890Q probably benign Het
Ccnj T A 19: 40,844,714 L112Q probably damaging Het
Chaf1a T C 17: 56,044,114 probably null Het
Chchd4 A G 6: 91,465,218 S73P probably damaging Het
Chd3 T C 11: 69,364,098 K139E possibly damaging Het
Cyp2b13 T G 7: 26,086,031 probably null Het
Dagla T C 19: 10,271,084 I71V possibly damaging Het
Epor A T 9: 21,959,640 W315R probably damaging Het
Etv1 T A 12: 38,783,810 probably null Het
Fbn2 A T 18: 58,069,242 C1280S probably damaging Het
Fbxo2 G C 4: 148,166,011 R269P probably damaging Het
Fer1l4 A T 2: 156,052,200 L61Q probably damaging Het
Ggnbp2 C T 11: 84,832,971 probably null Het
Gm498 T A 7: 143,894,063 Y214* probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ibsp G A 5: 104,310,394 E266K possibly damaging Het
Lamb3 T A 1: 193,330,784 M439K possibly damaging Het
Lnx1 C T 5: 74,620,123 V246M probably benign Het
Lrrc32 A G 7: 98,499,777 Q588R probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Med13 C T 11: 86,299,162 A974T possibly damaging Het
Mogat2 A T 7: 99,222,366 I246N possibly damaging Het
Myl2 T C 5: 122,104,685 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr406 T A 11: 74,270,223 V278D probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pik3r2 A G 8: 70,772,385 Y145H probably benign Het
Plg A G 17: 12,404,100 E509G possibly damaging Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ros1 C T 10: 52,172,840 probably null Het
Sbno1 A G 5: 124,388,572 M960T probably damaging Het
Smad1 T C 8: 79,353,455 probably null Het
Ssc5d G A 7: 4,936,907 probably null Het
Tfcp2 C T 15: 100,551,320 probably null Het
Tmem121 A G 12: 113,188,408 Y82C probably damaging Het
Tpp2 T A 1: 43,971,623 F523L probably damaging Het
Ttn C T 2: 76,771,505 silent Het
Ttpal A G 2: 163,615,583 probably null Het
Vdr T A 15: 97,859,127 Y288F probably benign Het
Wipf2 C T 11: 98,892,654 A302V probably benign Het
Zfp346 T G 13: 55,105,350 C3G possibly damaging Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3821:Tmem131 UTSW 1 36808396 missense probably damaging 0.99
R3961:Tmem131 UTSW 1 36818950 missense probably damaging 1.00
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4154:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7916:Tmem131 UTSW 1 36823086 missense probably benign 0.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTGCCCTAAACCTAATGTCCTG -3'
(R):5'- TCCATTGTACAACAGTGTGGC -3'

Sequencing Primer
(F):5'- CGCAGCTCCTAAAGGTTATCAGG -3'
(R):5'- GTACAACAGTGTGGCTAACTTG -3'
Posted On2015-01-23