Incidental Mutation 'R2879:Lamb3'
ID260212
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission 040467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2879 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 193330784 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 439 (M439K)
Ref Sequence ENSEMBL: ENSMUSP00000142053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016315
AA Change: M439K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: M439K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159955
AA Change: M439K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: M439K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161526
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194677
AA Change: M439K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: M439K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Akap9 A G 5: 3,976,353 probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Arhgef10l G T 4: 140,515,287 H890Q probably benign Het
Ccnj T A 19: 40,844,714 L112Q probably damaging Het
Chaf1a T C 17: 56,044,114 probably null Het
Chchd4 A G 6: 91,465,218 S73P probably damaging Het
Chd3 T C 11: 69,364,098 K139E possibly damaging Het
Cyp2b13 T G 7: 26,086,031 probably null Het
Dagla T C 19: 10,271,084 I71V possibly damaging Het
Epor A T 9: 21,959,640 W315R probably damaging Het
Etv1 T A 12: 38,783,810 probably null Het
Fbn2 A T 18: 58,069,242 C1280S probably damaging Het
Fbxo2 G C 4: 148,166,011 R269P probably damaging Het
Fer1l4 A T 2: 156,052,200 L61Q probably damaging Het
Ggnbp2 C T 11: 84,832,971 probably null Het
Gm498 T A 7: 143,894,063 Y214* probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ibsp G A 5: 104,310,394 E266K possibly damaging Het
Lnx1 C T 5: 74,620,123 V246M probably benign Het
Lrrc32 A G 7: 98,499,777 Q588R probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Med13 C T 11: 86,299,162 A974T possibly damaging Het
Mogat2 A T 7: 99,222,366 I246N possibly damaging Het
Myl2 T C 5: 122,104,685 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr406 T A 11: 74,270,223 V278D probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pik3r2 A G 8: 70,772,385 Y145H probably benign Het
Plg A G 17: 12,404,100 E509G possibly damaging Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ros1 C T 10: 52,172,840 probably null Het
Sbno1 A G 5: 124,388,572 M960T probably damaging Het
Smad1 T C 8: 79,353,455 probably null Het
Ssc5d G A 7: 4,936,907 probably null Het
Tfcp2 C T 15: 100,551,320 probably null Het
Tmem121 A G 12: 113,188,408 Y82C probably damaging Het
Tmem131 T C 1: 36,841,707 I161V possibly damaging Het
Tpp2 T A 1: 43,971,623 F523L probably damaging Het
Ttn C T 2: 76,771,505 silent Het
Ttpal A G 2: 163,615,583 probably null Het
Vdr T A 15: 97,859,127 Y288F probably benign Het
Wipf2 C T 11: 98,892,654 A302V probably benign Het
Zfp346 T G 13: 55,105,350 C3G possibly damaging Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 splice site probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
R8220:Lamb3 UTSW 1 193334248 missense probably damaging 1.00
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCAGAGTGAGAGTCTGGGAC -3'
(R):5'- GTCACTCATACCTGGTTGCAC -3'

Sequencing Primer
(F):5'- TGGGACACAGTACCCTGAG -3'
(R):5'- CTCATACCTGGTTGCACTGGGAG -3'
Posted On2015-01-23