Mutagenetix > Incidental Mutation

Incidental Mutation 'R2879:Pik3r2'

260233

Institutional Source

Beutler Lab

Gene Symbol

Pik3r2

Ensembl Gene

ENSMUSG00000031834

Gene Name

phosphoinositide-3-kinase regulatory subunit 2

Synonyms

p85beta

MMRRC Submission

040467-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70768176-70776713 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70772385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 145 (Y145H)

Ref Sequence

ENSEMBL: ENSMUSP00000034296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]

AlphaFold

O08908

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034296
AA Change: Y145H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: Y145H

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably benign
Transcript: ENSMUST00000143785

SMART Domains

Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	30	1e-8	BLAST
Pfam:SH2	33	70	4.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152545

Predicted Effect

unknown
Transcript: ENSMUST00000154685
AA Change: Y80H

SMART Domains

Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834
AA Change: Y80H

Domain	Start	End	E-Value	Type
PDB:2XS6\|A	43	84	3e-11	PDB
SCOP:d1pbwa_	47	79	6e-9	SMART
Blast:RhoGAP	58	84	4e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212384

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	C	17: 24,289,507	T1018R	probably damaging	Het
Akap9	A	G	5: 3,976,353		probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Ano6	T	A	15: 95,943,427	C468*	probably null	Het
Arhgef10l	G	T	4: 140,515,287	H890Q	probably benign	Het
Ccnj	T	A	19: 40,844,714	L112Q	probably damaging	Het
Chaf1a	T	C	17: 56,044,114		probably null	Het
Chchd4	A	G	6: 91,465,218	S73P	probably damaging	Het
Chd3	T	C	11: 69,364,098	K139E	possibly damaging	Het
Cyp2b13	T	G	7: 26,086,031		probably null	Het
Dagla	T	C	19: 10,271,084	I71V	possibly damaging	Het
Epor	A	T	9: 21,959,640	W315R	probably damaging	Het
Etv1	T	A	12: 38,783,810		probably null	Het
Fbn2	A	T	18: 58,069,242	C1280S	probably damaging	Het
Fbxo2	G	C	4: 148,166,011	R269P	probably damaging	Het
Fer1l4	A	T	2: 156,052,200	L61Q	probably damaging	Het
Ggnbp2	C	T	11: 84,832,971		probably null	Het
Gm498	T	A	7: 143,894,063	Y214*	probably null	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Ibsp	G	A	5: 104,310,394	E266K	possibly damaging	Het
Lamb3	T	A	1: 193,330,784	M439K	possibly damaging	Het
Lnx1	C	T	5: 74,620,123	V246M	probably benign	Het
Lrrc32	A	G	7: 98,499,777	Q588R	probably benign	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Med13	C	T	11: 86,299,162	A974T	possibly damaging	Het
Mogat2	A	T	7: 99,222,366	I246N	possibly damaging	Het
Myl2	T	C	5: 122,104,685		probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr406	T	A	11: 74,270,223	V278D	probably damaging	Het
Osbpl8	T	A	10: 111,269,436	S251T	probably benign	Het
Plg	A	G	17: 12,404,100	E509G	possibly damaging	Het
Pnkp	T	A	7: 44,858,678	S142T	probably damaging	Het
Ros1	C	T	10: 52,172,840		probably null	Het
Sbno1	A	G	5: 124,388,572	M960T	probably damaging	Het
Smad1	T	C	8: 79,353,455		probably null	Het
Ssc5d	G	A	7: 4,936,907		probably null	Het
Tfcp2	C	T	15: 100,551,320		probably null	Het
Tmem121	A	G	12: 113,188,408	Y82C	probably damaging	Het
Tmem131	T	C	1: 36,841,707	I161V	possibly damaging	Het
Tpp2	T	A	1: 43,971,623	F523L	probably damaging	Het
Ttn	C	T	2: 76,771,505		silent	Het
Ttpal	A	G	2: 163,615,583		probably null	Het
Vdr	T	A	15: 97,859,127	Y288F	probably benign	Het
Wipf2	C	T	11: 98,892,654	A302V	probably benign	Het
Zfp346	T	G	13: 55,105,350	C3G	possibly damaging	Het

Other mutations in Pik3r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Pik3r2	APN	8	70770429	missense	probably damaging	1.00
IGL01637:Pik3r2	APN	8	70772348	unclassified	probably benign
IGL02514:Pik3r2	APN	8	70770592	missense	probably benign	0.00
IGL03395:Pik3r2	APN	8	70772355	missense	probably benign
kingfisher	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0448:Pik3r2	UTSW	8	70772044	unclassified	probably benign
R1636:Pik3r2	UTSW	8	70771898	missense	probably benign
R1662:Pik3r2	UTSW	8	70770606	missense	probably damaging	1.00
R2114:Pik3r2	UTSW	8	70769385	missense	probably benign	0.31
R3830:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3852:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3859:Pik3r2	UTSW	8	70769986	missense	probably damaging	1.00
R3967:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3968:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3969:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3970:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R4606:Pik3r2	UTSW	8	70772136	nonsense	probably null
R4666:Pik3r2	UTSW	8	70768859	missense	possibly damaging	0.93
R5481:Pik3r2	UTSW	8	70769764	missense	probably benign	0.31
R6445:Pik3r2	UTSW	8	70772026	missense	probably benign	0.01
R6578:Pik3r2	UTSW	8	70772639	missense	probably benign	0.00
R6667:Pik3r2	UTSW	8	70769173	missense	probably damaging	1.00
R6794:Pik3r2	UTSW	8	70770717	missense	probably benign	0.43
R6863:Pik3r2	UTSW	8	70770414	missense	probably damaging	1.00
R7378:Pik3r2	UTSW	8	70769381	missense	probably benign	0.03
R7750:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R7821:Pik3r2	UTSW	8	70769764	missense	probably damaging	1.00
R8056:Pik3r2	UTSW	8	70772367	missense	probably benign	0.14
R8237:Pik3r2	UTSW	8	70772150	missense	probably benign	0.00
R8414:Pik3r2	UTSW	8	70770435	missense	probably damaging	1.00
R8534:Pik3r2	UTSW	8	70774668	missense	probably benign
R8781:Pik3r2	UTSW	8	70769402	missense	possibly damaging	0.88
R8794:Pik3r2	UTSW	8	70771363	missense	probably benign
R9322:Pik3r2	UTSW	8	70774850	missense	possibly damaging	0.74
R9401:Pik3r2	UTSW	8	70771093	missense	possibly damaging	0.77
R9668:Pik3r2	UTSW	8	70768815	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAACAGCATCATACAAGGCGG -3'
(R):5'- TTGAGCAAGCAGGTGAGGTC -3'

Sequencing Primer
(F):5'- CATCATACAAGGCGGTGCGG -3'
(R):5'- AAGCAGGTGAGGTCCAGCC -3'

Posted On

2015-01-23