Mutagenetix > Incidental Mutation

Incidental Mutation 'R0331:Cfap65'

26024

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

038540-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.676) question?

Stock #

R0331 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 74929302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 124 (P124T)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: P124T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: P124T

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Meta Mutation Damage Score

0.2722

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.8%
20x: 91.7%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	A	8: 79,229,392	T79S	probably benign	Het
Abtb1	T	C	6: 88,840,702		probably benign	Het
Acot12	G	A	13: 91,760,064		probably null	Het
Adamts4	T	A	1: 171,250,972	S54T	probably benign	Het
Adgrl4	T	C	3: 151,497,940	S96P	probably benign	Het
Aip	G	T	19: 4,118,247	T40K	probably damaging	Het
Anapc4	A	G	5: 52,855,642		probably benign	Het
Asz1	A	G	6: 18,103,619		probably benign	Het
Atf7ip	A	G	6: 136,561,163	T465A	possibly damaging	Het
Atp11a	C	T	8: 12,816,953	Q127*	probably null	Het
Axin1	A	G	17: 26,143,107	R142G	probably damaging	Het
B230359F08Rik	A	G	14: 53,795,748	N38S	probably benign	Het
Bcat1	T	A	6: 145,047,314	E86V	probably benign	Het
Brd4	G	A	17: 32,202,515	P749L	probably benign	Het
C1ra	G	A	6: 124,519,435		probably null	Het
Capza2	A	T	6: 17,665,103	N237I	probably benign	Het
Cd2ap	A	T	17: 42,805,301	V556E	probably benign	Het
Cftr	T	C	6: 18,235,226	V488A	possibly damaging	Het
Ckmt1	A	T	2: 121,362,856		probably null	Het
Cmya5	T	G	13: 93,144,403	E35A	possibly damaging	Het
Col7a1	A	G	9: 108,967,502		probably benign	Het
Crmp1	C	T	5: 37,265,313	L155F	possibly damaging	Het
Cyp2d10	T	A	15: 82,407,026	T33S	probably benign	Het
Dhdh	T	C	7: 45,488,120	K48E	probably benign	Het
Dlst	T	C	12: 85,118,812	V103A	probably damaging	Het
Dohh	C	T	10: 81,387,812	T233I	probably benign	Het
Dvl2	C	A	11: 70,006,217		probably benign	Het
Eipr1	C	T	12: 28,864,704	Q286*	probably null	Het
Enpp6	C	A	8: 47,082,449	T343K	probably damaging	Het
Fbxw11	T	A	11: 32,711,895	F112I	probably damaging	Het
Gdpd4	T	A	7: 97,973,008	N231K	probably benign	Het
Gm6370	A	T	5: 146,493,766	T254S	probably benign	Het
Hapln4	G	T	8: 70,084,509	Q31H	probably damaging	Het
Hic1	T	A	11: 75,165,490	T858S	possibly damaging	Het
Isg20l2	T	C	3: 87,931,785	L101P	probably damaging	Het
Itga10	T	C	3: 96,652,483	Y485H	probably damaging	Het
Itgal	T	A	7: 127,306,681		probably null	Het
Itln1	T	C	1: 171,531,549	N62S	probably damaging	Het
Kdm4b	T	C	17: 56,386,289		probably benign	Het
Lct	T	C	1: 128,298,742		probably benign	Het
Lman2	A	T	13: 55,353,016	H123Q	probably damaging	Het
Lztr1	T	A	16: 17,524,237		probably benign	Het
Myo3b	G	T	2: 70,095,261	G24V	probably damaging	Het
Nacad	T	A	11: 6,599,441	Q1250L	possibly damaging	Het
Ncor2	A	T	5: 125,084,917	M431K	unknown	Het
Nek9	T	A	12: 85,327,375		probably benign	Het
Neu1	C	A	17: 34,934,170	N255K	possibly damaging	Het
Nf2	T	A	11: 4,794,914	T75S	probably benign	Het
Nipal4	T	A	11: 46,150,213	D385V	probably damaging	Het
Olah	T	A	2: 3,342,474	N245I	probably damaging	Het
Olfr474	G	T	7: 107,954,870	L76F	probably benign	Het
Pag1	T	A	3: 9,701,970	T90S	probably benign	Het
Pald1	A	G	10: 61,340,929		probably null	Het
Parva	A	G	7: 112,544,798	M98V	probably benign	Het
Paxbp1	T	A	16: 91,037,367	D177V	possibly damaging	Het
Paxip1	A	G	5: 27,765,232	I587T	probably damaging	Het
Pclo	T	C	5: 14,680,376		probably benign	Het
Pdgfra	T	A	5: 75,195,052	D1074E	probably damaging	Het
Pef1	A	T	4: 130,127,448	D265V	probably damaging	Het
Plekhh2	G	A	17: 84,586,366	E870K	possibly damaging	Het
Plscr4	G	A	9: 92,482,642	G40D	probably damaging	Het
Psg18	A	G	7: 18,353,308	Y142H	probably benign	Het
Ptchd3	A	T	11: 121,842,191	M636L	probably benign	Het
Rab2a	A	G	4: 8,572,559	D51G	probably benign	Het
Rnf139	T	A	15: 58,899,906	D593E	probably benign	Het
Sept7	A	G	9: 25,306,256	N422S	probably benign	Het
Shprh	T	C	10: 11,194,170		probably benign	Het
Slc7a6os	A	G	8: 106,210,567	I87T	probably damaging	Het
Slc7a7	A	G	14: 54,377,924		probably benign	Het
Spc24	G	T	9: 21,757,313	N129K	possibly damaging	Het
Strip2	C	T	6: 29,926,560	T148I	probably benign	Het
Tmem150c	A	C	5: 100,086,273		probably null	Het
Ttn	G	T	2: 76,811,020	Y11801*	probably null	Het
Usp37	A	T	1: 74,454,064	L688*	probably null	Het
Usp38	T	C	8: 80,995,840	I351V	probably benign	Het
Vav2	T	A	2: 27,296,175	M223L	probably benign	Het
Wdr36	A	G	18: 32,852,915	I557M	possibly damaging	Het
Wwc2	A	T	8: 47,880,204	M259K	probably benign	Het
Znfx1	G	A	2: 167,046,978	S770L	probably benign	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGCAGAGAGTAAGTGCCTAACG -3'
(R):5'- ATAGGTCCCCTTACAATCTGACCCC -3'

Sequencing Primer
(F):5'- gcttgcttctgcttcccaaac -3'
(R):5'- TGACCCCTTAAAGAGTGACTTC -3'

Posted On

2013-04-16