Incidental Mutation 'R2879:Vdr'
ID260252
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission 040467-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2879 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97859127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 288 (Y288F)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably benign
Transcript: ENSMUST00000023119
AA Change: Y288F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: Y288F

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Akap9 A G 5: 3,976,353 probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Arhgef10l G T 4: 140,515,287 H890Q probably benign Het
Ccnj T A 19: 40,844,714 L112Q probably damaging Het
Chaf1a T C 17: 56,044,114 probably null Het
Chchd4 A G 6: 91,465,218 S73P probably damaging Het
Chd3 T C 11: 69,364,098 K139E possibly damaging Het
Cyp2b13 T G 7: 26,086,031 probably null Het
Dagla T C 19: 10,271,084 I71V possibly damaging Het
Epor A T 9: 21,959,640 W315R probably damaging Het
Etv1 T A 12: 38,783,810 probably null Het
Fbn2 A T 18: 58,069,242 C1280S probably damaging Het
Fbxo2 G C 4: 148,166,011 R269P probably damaging Het
Fer1l4 A T 2: 156,052,200 L61Q probably damaging Het
Ggnbp2 C T 11: 84,832,971 probably null Het
Gm498 T A 7: 143,894,063 Y214* probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ibsp G A 5: 104,310,394 E266K possibly damaging Het
Lamb3 T A 1: 193,330,784 M439K possibly damaging Het
Lnx1 C T 5: 74,620,123 V246M probably benign Het
Lrrc32 A G 7: 98,499,777 Q588R probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Med13 C T 11: 86,299,162 A974T possibly damaging Het
Mogat2 A T 7: 99,222,366 I246N possibly damaging Het
Myl2 T C 5: 122,104,685 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr406 T A 11: 74,270,223 V278D probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pik3r2 A G 8: 70,772,385 Y145H probably benign Het
Plg A G 17: 12,404,100 E509G possibly damaging Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ros1 C T 10: 52,172,840 probably null Het
Sbno1 A G 5: 124,388,572 M960T probably damaging Het
Smad1 T C 8: 79,353,455 probably null Het
Ssc5d G A 7: 4,936,907 probably null Het
Tfcp2 C T 15: 100,551,320 probably null Het
Tmem121 A G 12: 113,188,408 Y82C probably damaging Het
Tmem131 T C 1: 36,841,707 I161V possibly damaging Het
Tpp2 T A 1: 43,971,623 F523L probably damaging Het
Ttn C T 2: 76,771,505 silent Het
Ttpal A G 2: 163,615,583 probably null Het
Wipf2 C T 11: 98,892,654 A302V probably benign Het
Zfp346 T G 13: 55,105,350 C3G possibly damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R0400:Vdr UTSW 15 97869351 missense probably benign 0.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R3030:Vdr UTSW 15 97857563 missense probably benign 0.00
R4695:Vdr UTSW 15 97858920 splice site probably null
R5074:Vdr UTSW 15 97857578 missense probably benign 0.35
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5710:Vdr UTSW 15 97867208 missense probably benign 0.02
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6776:Vdr UTSW 15 97869828 missense probably damaging 1.00
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
R7870:Vdr UTSW 15 97884890 missense possibly damaging 0.59
R7953:Vdr UTSW 15 97884890 missense possibly damaging 0.59
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGAGGGGTTCGATCAGCTC -3'
(R):5'- GTTGCCTGAGACTTGAACCAG -3'

Sequencing Primer
(F):5'- TGAGGTAGAGACATCCACCCG -3'
(R):5'- CTGAGACTTGAACCAGTTACCTG -3'
Posted On2015-01-23