Incidental Mutation 'R2880:Slc5a11'
ID260279
Institutional Source Beutler Lab
Gene Symbol Slc5a11
Ensembl Gene ENSMUSG00000030769
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 11
Synonyms2010013B02Rik, Kst1
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2880 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location123214780-123273253 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGTGC to G at 123239372 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033035] [ENSMUST00000127655] [ENSMUST00000131461] [ENSMUST00000131933] [ENSMUST00000167299]
Predicted Effect probably null
Transcript: ENSMUST00000033035
SMART Domains Protein: ENSMUSP00000033035
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 487 2.2e-143 PFAM
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 653 672 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127655
SMART Domains Protein: ENSMUSP00000117956
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 152 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131209
SMART Domains Protein: ENSMUSP00000120678
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
Pfam:SSF 7 72 8.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131461
SMART Domains Protein: ENSMUSP00000123027
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131933
SMART Domains Protein: ENSMUSP00000121459
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 402 1.2e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167299
SMART Domains Protein: ENSMUSP00000127977
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 487 2.2e-143 PFAM
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 653 672 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cotransporters, such as SLC5A11, represent a major class of proteins that make use of ion gradients to drive active transport for the cellular accumulation of nutrients, neurotransmitters, osmolytes, and ions Roll et al. (2002) [PubMed 12039040].[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Slc5a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Slc5a11 APN 7 123250174 missense probably null 0.72
IGL01670:Slc5a11 APN 7 123269949 missense probably benign
IGL01960:Slc5a11 APN 7 123269940 missense probably benign 0.00
IGL02512:Slc5a11 APN 7 123265255 missense probably damaging 0.96
IGL02637:Slc5a11 APN 7 123260505 critical splice acceptor site probably null
IGL02680:Slc5a11 APN 7 123265631 missense probably damaging 1.00
IGL03185:Slc5a11 APN 7 123265189 missense possibly damaging 0.61
R0454:Slc5a11 UTSW 7 123265235 missense possibly damaging 0.83
R0894:Slc5a11 UTSW 7 123258420 missense possibly damaging 0.91
R1501:Slc5a11 UTSW 7 123260508 missense probably damaging 1.00
R1879:Slc5a11 UTSW 7 123239448 missense possibly damaging 0.91
R2185:Slc5a11 UTSW 7 123273198 missense probably damaging 0.96
R2882:Slc5a11 UTSW 7 123239372 frame shift probably null
R2919:Slc5a11 UTSW 7 123239372 frame shift probably null
R3012:Slc5a11 UTSW 7 123239372 frame shift probably null
R4307:Slc5a11 UTSW 7 123269870 missense probably benign 0.01
R4405:Slc5a11 UTSW 7 123258477 missense probably damaging 1.00
R4510:Slc5a11 UTSW 7 123235635 missense probably benign 0.05
R4511:Slc5a11 UTSW 7 123235635 missense probably benign 0.05
R4599:Slc5a11 UTSW 7 123258378 missense probably benign 0.00
R4660:Slc5a11 UTSW 7 123265263 missense probably damaging 1.00
R5822:Slc5a11 UTSW 7 123252431 missense probably damaging 1.00
R6641:Slc5a11 UTSW 7 123238155 missense probably benign 0.01
R6694:Slc5a11 UTSW 7 123267789 missense possibly damaging 0.65
R7078:Slc5a11 UTSW 7 123258446 missense probably damaging 1.00
R7580:Slc5a11 UTSW 7 123265198 missense probably damaging 1.00
Z1177:Slc5a11 UTSW 7 123239390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCAGACACTTTCTCAAG -3'
(R):5'- GAAGCCTCCTGTTTGCTTAACG -3'

Sequencing Primer
(F):5'- GCAGACACTTTCTCAAGTTGTG -3'
(R):5'- GCCTCCTGTTTGCTTAACGAAAAG -3'
Posted On2015-01-23