Incidental Mutation 'R2880:Mtnr1b'
ID260282
Institutional Source Beutler Lab
Gene Symbol Mtnr1b
Ensembl Gene ENSMUSG00000050901
Gene Namemelatonin receptor 1B
SynonymsMt2, Mel1b
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15824528-15874556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15862806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 319 (Y319S)
Ref Sequence ENSEMBL: ENSMUSP00000138524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057920] [ENSMUST00000182947]
Predicted Effect probably damaging
Transcript: ENSMUST00000057920
AA Change: Y319S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053086
Gene: ENSMUSG00000050901
AA Change: Y319S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 254 3.7e-11 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 3.4e-47 PFAM
Pfam:7TM_GPCR_Srv 59 317 1.1e-7 PFAM
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182947
AA Change: Y319S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138524
Gene: ENSMUSG00000050901
AA Change: Y319S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 264 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 1.4e-50 PFAM
Pfam:7TM_GPCR_Srv 59 319 7.5e-8 PFAM
low complexity region 348 359 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no obvious circadian phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Mtnr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Mtnr1b APN 9 15863200 missense probably damaging 1.00
IGL02041:Mtnr1b APN 9 15863293 missense probably benign 0.01
IGL02054:Mtnr1b APN 9 15874240 missense possibly damaging 0.93
IGL02147:Mtnr1b APN 9 15863376 missense probably damaging 0.96
IGL02620:Mtnr1b APN 9 15874321 missense possibly damaging 0.47
IGL03046:Mtnr1b UTSW 9 15862763 missense probably benign 0.00
R0362:Mtnr1b UTSW 9 15874304 missense probably damaging 1.00
R0784:Mtnr1b UTSW 9 15862785 missense probably benign 0.17
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1572:Mtnr1b UTSW 9 15863142 missense probably damaging 0.99
R1600:Mtnr1b UTSW 9 15863319 missense probably damaging 0.99
R2932:Mtnr1b UTSW 9 15874324 missense probably damaging 0.97
R4033:Mtnr1b UTSW 9 15863534 missense probably damaging 1.00
R5532:Mtnr1b UTSW 9 15862914 missense probably benign
R5765:Mtnr1b UTSW 9 15863163 missense probably damaging 1.00
R5775:Mtnr1b UTSW 9 15862872 missense possibly damaging 0.73
R5893:Mtnr1b UTSW 9 15863244 missense probably damaging 0.98
R6025:Mtnr1b UTSW 9 15862797 missense probably damaging 1.00
R6247:Mtnr1b UTSW 9 15862786 missense probably benign
R6349:Mtnr1b UTSW 9 15863213 nonsense probably null
R6364:Mtnr1b UTSW 9 15863004 missense possibly damaging 0.63
R7485:Mtnr1b UTSW 9 15863294 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCACTTCACAGGTTTGCTG -3'
(R):5'- GCGCAGTTTCCTAACCATG -3'

Sequencing Primer
(F):5'- CACTTCACAGGTTTGCTGCTAGG -3'
(R):5'- GCAGTTTCCTAACCATGTTTGCAG -3'
Posted On2015-01-23