Incidental Mutation 'R2880:Ewsr1'
ID260285
Institutional Source Beutler Lab
Gene Symbol Ewsr1
Ensembl Gene ENSMUSG00000009079
Gene NameEwing sarcoma breakpoint region 1
SynonymsEws
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5069689-5099266 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 5078523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073308] [ENSMUST00000079949] [ENSMUST00000093365] [ENSMUST00000102930]
Predicted Effect unknown
Transcript: ENSMUST00000073308
AA Change: V334L
SMART Domains Protein: ENSMUSP00000073034
Gene: ENSMUSG00000009079
AA Change: V334L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 5.91e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 5.91e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
RRM 324 405 8.38e-17 SMART
low complexity region 416 475 N/A INTRINSIC
ZnF_RBZ 482 508 6.22e-7 SMART
low complexity region 512 586 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079949
AA Change: V371L
SMART Domains Protein: ENSMUSP00000078867
Gene: ENSMUSG00000009079
AA Change: V371L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.98e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.98e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 331 N/A INTRINSIC
low complexity region 335 356 N/A INTRINSIC
RRM 361 442 8.38e-17 SMART
low complexity region 453 512 N/A INTRINSIC
ZnF_RBZ 519 545 6.22e-7 SMART
low complexity region 549 623 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093365
SMART Domains Protein: ENSMUSP00000091057
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.29e-5 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.29e-5 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000102930
AA Change: V377L
SMART Domains Protein: ENSMUSP00000099994
Gene: ENSMUSG00000009079
AA Change: V377L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 3.23e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 97 127 N/A INTRINSIC
internal_repeat_1 161 176 3.23e-6 PROSPERO
low complexity region 193 217 N/A INTRINSIC
low complexity region 219 272 N/A INTRINSIC
low complexity region 306 337 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
RRM 367 448 8.38e-17 SMART
low complexity region 459 518 N/A INTRINSIC
ZnF_RBZ 525 551 6.22e-7 SMART
low complexity region 555 629 N/A INTRINSIC
low complexity region 635 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151497
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, defective pre-B cell development, apoptosis of gametes and arrest in gamete maturation due to reduced meiotic recombination leading to infertility, kyphosis, lymphopenia, muscular atrophy, and hypersensitivity to ionizing radiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Ewsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ewsr1 APN 11 5088077 missense probably damaging 1.00
IGL02218:Ewsr1 APN 11 5070668 missense unknown
IGL02288:Ewsr1 APN 11 5093689 missense possibly damaging 0.53
IGL02410:Ewsr1 APN 11 5093863 splice site probably benign
R0485:Ewsr1 UTSW 11 5070737 splice site probably benign
R0570:Ewsr1 UTSW 11 5085935 missense possibly damaging 0.80
R1546:Ewsr1 UTSW 11 5078574 unclassified probably benign
R1688:Ewsr1 UTSW 11 5072870 missense unknown
R2074:Ewsr1 UTSW 11 5071555 missense unknown
R2158:Ewsr1 UTSW 11 5091450 splice site probably benign
R2326:Ewsr1 UTSW 11 5091857 critical splice donor site probably null
R2881:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2882:Ewsr1 UTSW 11 5078523 unclassified probably benign
R3965:Ewsr1 UTSW 11 5083476 missense unknown
R4743:Ewsr1 UTSW 11 5083541 missense unknown
R4782:Ewsr1 UTSW 11 5070423 missense unknown
R5023:Ewsr1 UTSW 11 5088054 missense possibly damaging 0.83
R5194:Ewsr1 UTSW 11 5082355 missense unknown
R5422:Ewsr1 UTSW 11 5080668 intron probably benign
R5790:Ewsr1 UTSW 11 5082263 intron probably benign
R6993:Ewsr1 UTSW 11 5071573 missense probably benign 0.23
R7719:Ewsr1 UTSW 11 5085900 missense unknown
Predicted Primers PCR Primer
(F):5'- CACAATCATCAGCTGCTTAGC -3'
(R):5'- GTCCGATTGGTTAAGAAGCCC -3'

Sequencing Primer
(F):5'- GCCAGAATGCATGAGATCTTGTC -3'
(R):5'- AGAAGCCCCTATTATTATCTAGGCC -3'
Posted On2015-01-23