Incidental Mutation 'R2880:Rnf112'
ID260286
Institutional Source Beutler Lab
Gene Symbol Rnf112
Ensembl Gene ENSMUSG00000010086
Gene Namering finger protein 112
SynonymsZfp179, bfp
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61448442-61454131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61450467 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 431 (H431Y)
Ref Sequence ENSEMBL: ENSMUSP00000059903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054927
AA Change: H406Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: H406Y

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 423 1.3e-21 PFAM
low complexity region 541 557 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060255
AA Change: H431Y

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: H431Y

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 448 2.8e-21 PFAM
low complexity region 566 582 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102661
AA Change: H383Y

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: H383Y

DomainStartEndE-ValueType
RING 57 97 1.7e-7 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:GBP 148 400 2.7e-19 PFAM
low complexity region 518 534 N/A INTRINSIC
transmembrane domain 547 569 N/A INTRINSIC
transmembrane domain 582 604 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Rnf112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rnf112 APN 11 61452784 missense probably damaging 1.00
IGL01339:Rnf112 APN 11 61450477 missense probably benign 0.00
IGL01469:Rnf112 APN 11 61451341 missense possibly damaging 0.94
IGL02102:Rnf112 APN 11 61452015 missense probably benign 0.36
IGL02216:Rnf112 APN 11 61449978 missense probably damaging 1.00
IGL02431:Rnf112 APN 11 61450379 missense probably benign 0.17
IGL02638:Rnf112 APN 11 61449405 utr 3 prime probably benign
IGL02657:Rnf112 APN 11 61450252 splice site probably null
R0041:Rnf112 UTSW 11 61452355 missense probably damaging 1.00
R1514:Rnf112 UTSW 11 61450410 missense probably benign 0.01
R1991:Rnf112 UTSW 11 61452426 missense probably damaging 1.00
R2119:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R2216:Rnf112 UTSW 11 61452279 missense probably damaging 1.00
R3775:Rnf112 UTSW 11 61450185 splice site probably benign
R3904:Rnf112 UTSW 11 61450385 missense probably damaging 1.00
R4646:Rnf112 UTSW 11 61452110 missense probably damaging 0.99
R4710:Rnf112 UTSW 11 61449831 missense probably damaging 1.00
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4894:Rnf112 UTSW 11 61452662 missense probably damaging 1.00
R4930:Rnf112 UTSW 11 61453465 missense probably benign
R4967:Rnf112 UTSW 11 61452926 splice site probably benign
R4992:Rnf112 UTSW 11 61452711 missense possibly damaging 0.72
R5547:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R5874:Rnf112 UTSW 11 61449447 missense probably damaging 0.98
R5997:Rnf112 UTSW 11 61451022 missense possibly damaging 0.87
R6023:Rnf112 UTSW 11 61449729 missense probably damaging 1.00
R6906:Rnf112 UTSW 11 61450389 missense probably null 0.38
R7194:Rnf112 UTSW 11 61450857 missense probably damaging 1.00
R7439:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
Z1177:Rnf112 UTSW 11 61449679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCCTCAGGAACTTTTCAC -3'
(R):5'- CAGAAGCTGTCCGGCAAATACC -3'

Sequencing Primer
(F):5'- CAGGAACTTTTCACACCTTGATC -3'
(R):5'- AGCTGCTCCTCGGGAAAC -3'
Posted On2015-01-23