Incidental Mutation 'R2880:Cd300c'
ID260291
Institutional Source Beutler Lab
Gene Symbol Cd300c
Ensembl Gene ENSMUSG00000058728
Gene NameCD300C molecule
SynonymsClm6
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114956116-114969157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114959790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 62 (N62K)
Ref Sequence ENSEMBL: ENSMUSP00000090123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061637] [ENSMUST00000092466]
Predicted Effect probably benign
Transcript: ENSMUST00000061637
AA Change: N62K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052647
Gene: ENSMUSG00000058728
AA Change: N62K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 28 133 2.48e-8 SMART
low complexity region 174 187 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092466
AA Change: N62K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090123
Gene: ENSMUSG00000058728
AA Change: N62K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 28 133 2.48e-8 SMART
low complexity region 174 187 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106580
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Cd300c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cd300c APN 11 114959790 missense probably benign
IGL01067:Cd300c APN 11 114960427 unclassified probably benign
R0325:Cd300c UTSW 11 114959585 nonsense probably null
R1471:Cd300c UTSW 11 114959788 missense probably benign 0.09
R3830:Cd300c UTSW 11 114959627 missense probably benign 0.00
R6369:Cd300c UTSW 11 114957555 missense probably damaging 1.00
R7240:Cd300c UTSW 11 114959783 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACCTCAACCTTGAAGGACTTATCG -3'
(R):5'- CTGACGCAAGGGAAGACTTC -3'

Sequencing Primer
(F):5'- AGGACTTATCGATCTGTAAGTAGGC -3'
(R):5'- CAGTGTGTCCTGTCAGTA -3'
Posted On2015-01-23