Incidental Mutation 'R2880:Gm9637'
ID260294
Institutional Source Beutler Lab
Gene Symbol Gm9637
Ensembl Gene ENSMUSG00000093814
Gene Namepredicted gene 9637
Synonyms
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19401727-19402599 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 19401978 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179141
SMART Domains Protein: ENSMUSP00000137522
Gene: ENSMUSG00000093814

DomainStartEndE-ValueType
S_TKc 36 283 1.12e-85 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Gm9637
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Gm9637 APN 14 19402545 exon noncoding transcript
IGL02449:Gm9637 APN 14 19402436 exon noncoding transcript
IGL02492:Gm9637 APN 14 19402182 exon noncoding transcript
IGL03060:Gm9637 APN 14 19402173 exon noncoding transcript
R0062:Gm9637 UTSW 14 19402570 exon noncoding transcript
R0621:Gm9637 UTSW 14 19402011 exon noncoding transcript
R1122:Gm9637 UTSW 14 19401879 exon noncoding transcript
R1762:Gm9637 UTSW 14 19402408 exon noncoding transcript
R1812:Gm9637 UTSW 14 19402395 exon noncoding transcript
R3685:Gm9637 UTSW 14 19401950 exon noncoding transcript
R3810:Gm9637 UTSW 14 19402398 exon noncoding transcript
R3812:Gm9637 UTSW 14 19402398 exon noncoding transcript
R5415:Gm9637 UTSW 14 19402143 exon noncoding transcript
Z1088:Gm9637 UTSW 14 19401731 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AATGTCATGGACTGTTGGCC -3'
(R):5'- TTGTAACCAGAAGGGGATTGTCC -3'

Sequencing Primer
(F):5'- CTCTCCAGGGTTGACAGTTAGC -3'
(R):5'- TCCACAGGGATTTAAAGCCAG -3'
Posted On2015-01-23