Incidental Mutation 'R2880:Lmf2'
ID260297
Institutional Source Beutler Lab
Gene Symbol Lmf2
Ensembl Gene ENSMUSG00000022614
Gene Namelipase maturation factor 2
SynonymsTmem153, Tmem112b
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89351004-89355659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89351653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 683 (S683P)
Ref Sequence ENSEMBL: ENSMUSP00000023283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023283] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000229111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023283
AA Change: S683P

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023283
Gene: ENSMUSG00000022614
AA Change: S683P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Pfam:LMF1 122 589 5.6e-164 PFAM
low complexity region 679 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141643
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145793
Predicted Effect probably benign
Transcript: ENSMUST00000229111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231107
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Lmf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Lmf2 APN 15 89353336 missense probably benign 0.00
IGL00953:Lmf2 APN 15 89353899 missense probably damaging 1.00
IGL00987:Lmf2 APN 15 89354568 missense probably benign
IGL01069:Lmf2 APN 15 89352888 missense probably benign 0.35
IGL01340:Lmf2 APN 15 89352872 missense probably damaging 0.98
IGL01878:Lmf2 APN 15 89352418 missense probably damaging 1.00
IGL02588:Lmf2 APN 15 89355406 unclassified probably null
IGL02698:Lmf2 APN 15 89354154 missense probably damaging 1.00
PIT4651001:Lmf2 UTSW 15 89352069 missense possibly damaging 0.58
R1761:Lmf2 UTSW 15 89352713 missense possibly damaging 0.61
R2355:Lmf2 UTSW 15 89351763 missense possibly damaging 0.65
R4896:Lmf2 UTSW 15 89351800 missense probably benign 0.16
R5141:Lmf2 UTSW 15 89351607 unclassified probably null
R6785:Lmf2 UTSW 15 89352033 missense probably benign 0.43
R7301:Lmf2 UTSW 15 89355530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGTGACACCCAGCATTC -3'
(R):5'- TAGCTCAGACACTGAACTGGGTG -3'

Sequencing Primer
(F):5'- TGACACCCAGCATTCCTCGG -3'
(R):5'- ACACTGAACTGGGTGCGGAC -3'
Posted On2015-01-23