Mutagenetix > Incidental Mutations

Incidental Mutation 'R2880:Blnk'

260301

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

040468-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R2880 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40962455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 84 (Y84C)

Ref Sequence

ENSEMBL: ENSMUSP00000057844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

PDB Structure

Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054769
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: Y84C

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117695
AA Change: Y84C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: Y84C

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134568

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano4	C	T	10: 89,112,799	E150K	probably damaging	Het
Brinp3	G	A	1: 146,902,002	R729H	probably damaging	Het
Bsn	C	T	9: 108,113,067	A1829T	possibly damaging	Het
Cd300c	A	T	11: 114,959,790	N62K	probably benign	Het
Chd3	T	C	11: 69,352,120	D1425G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Gm4076	G	A	13: 85,127,238		noncoding transcript	Het
Gm9637	A	G	14: 19,401,978		noncoding transcript	Het
Greb1l	A	T	18: 10,547,288	N1502I	possibly damaging	Het
H13	A	G	2: 152,695,561	M309V	probably damaging	Het
Lmf2	A	G	15: 89,351,653	S683P	possibly damaging	Het
Lrit1	T	A	14: 37,057,437	L109Q	probably damaging	Het
Maml2	A	T	9: 13,620,597		probably null	Het
Map3k14	C	A	11: 103,221,032	R941L	probably damaging	Het
Megf6	A	G	4: 154,252,549	K262E	probably damaging	Het
Mtnr1b	T	G	9: 15,862,806	Y319S	probably damaging	Het
Myh8	A	G	11: 67,297,264	K954R	probably damaging	Het
Myof	T	C	19: 37,923,025	D1486G	probably benign	Het
Nbea	A	G	3: 55,647,358	V2623A	probably benign	Het
Pak1	T	A	7: 97,904,811	Y463N	probably damaging	Het
Pex5l	T	A	3: 32,993,003		probably null	Het
Rasa4	T	C	5: 136,091,771	V87A	probably damaging	Het
Rnf112	G	A	11: 61,450,467	H431Y	possibly damaging	Het
Slc25a30	A	G	14: 75,770,211	V118A	probably benign	Het
Slc4a7	T	A	14: 14,773,277	I872K	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Sycp1	T	C	3: 102,818,898	E970G	probably damaging	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tgfb2	T	A	1: 186,704,555	T74S	probably damaging	Het
Vmn2r65	A	T	7: 84,963,886	C42S	probably damaging	Het
Zbtb12	T	A	17: 34,895,479	I80N	probably damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81
R8798:Blnk	UTSW	19	40962351	missense	probably damaging	1.00
R9094:Blnk	UTSW	19	40994039	missense	probably benign	0.39
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCAGCTGTTTGCCCATCTC -3'
(R):5'- ACTGGAAAGTCCTGTGTGATC -3'

Sequencing Primer
(F):5'- CCATCTCCCCCATCCTGTG -3'
(R):5'- AAAGTCCTGTGTGATCATGGCAG -3'

Posted On

2015-01-23