Incidental Mutation 'R2880:Blnk'
ID 260301
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene Name B cell linker
Synonyms BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R2880 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40928927-40994535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40962455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 84 (Y84C)
Ref Sequence ENSEMBL: ENSMUSP00000057844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
AlphaFold Q9QUN3
PDB Structure Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000054769
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: Y84C

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117695
AA Change: Y84C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: Y84C

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134568
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8473:Blnk UTSW 19 40952410 missense possibly damaging 0.81
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
R9094:Blnk UTSW 19 40994039 missense probably benign 0.39
R9139:Blnk UTSW 19 40934518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCTGTTTGCCCATCTC -3'
(R):5'- ACTGGAAAGTCCTGTGTGATC -3'

Sequencing Primer
(F):5'- CCATCTCCCCCATCCTGTG -3'
(R):5'- AAAGTCCTGTGTGATCATGGCAG -3'
Posted On 2015-01-23