Incidental Mutation 'R2881:Olfr1256'
ID260305
Institutional Source Beutler Lab
Gene Symbol Olfr1256
Ensembl Gene ENSMUSG00000075073
Gene Nameolfactory receptor 1256
SynonymsGA_x6K02T2Q125-51276848-51275928, MOR231-1
MMRRC Submission 040469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2881 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89825311-89841555 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 89844984 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect probably null
Transcript: ENSMUST00000099762
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099762
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably benign
Transcript: ENSMUST00000214428
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216674
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,270 C385S probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Camta2 A T 11: 70,679,664 probably null Het
Ces1d C A 8: 93,195,031 G35W probably damaging Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Coasy G A 11: 101,085,849 V482I possibly damaging Het
Cyp2j9 A T 4: 96,574,012 V344E probably damaging Het
Dhx30 A T 9: 110,098,845 Y73* probably null Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Faap100 T C 11: 120,374,359 T564A probably damaging Het
Galc A G 12: 98,213,096 M518T probably benign Het
Gm15448 T A 7: 3,825,641 M1L probably null Het
Gm340 A G 19: 41,583,049 E227G probably damaging Het
Gpatch8 A G 11: 102,479,917 Y932H unknown Het
Hace1 T A 10: 45,671,134 M471K probably benign Het
Irf2bpl T A 12: 86,882,777 D374V probably damaging Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Olfr206 A T 16: 59,344,852 L283Q probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Sgo2b T C 8: 63,927,536 Y754C probably damaging Het
She T A 3: 89,831,924 C141S probably benign Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Vmn2r88 G T 14: 51,418,689 C794F probably damaging Het
Zfp871 T C 17: 32,775,433 K256R probably damaging Het
Other mutations in Olfr1256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Olfr1256 APN 2 89835458 nonsense probably null
IGL01082:Olfr1256 APN 2 89844063 unclassified probably benign
IGL01613:Olfr1256 APN 2 89835808 missense probably damaging 0.98
IGL01969:Olfr1256 APN 2 89835720 missense probably benign 0.01
IGL02625:Olfr1256 APN 2 89835396 missense probably damaging 1.00
R0843:Olfr1256 UTSW 2 89835616 missense probably benign 0.01
R1270:Olfr1256 UTSW 2 89835322 missense possibly damaging 0.90
R1521:Olfr1256 UTSW 2 89835172 nonsense probably null
R2219:Olfr1256 UTSW 2 89835425 missense probably damaging 1.00
R3121:Olfr1256 UTSW 2 89835514 missense probably benign
R3609:Olfr1256 UTSW 2 89835076 missense probably damaging 0.99
R4984:Olfr1256 UTSW 2 89835813 missense probably damaging 1.00
R5153:Olfr1256 UTSW 2 89835234 missense possibly damaging 0.77
R5640:Olfr1256 UTSW 2 89835938 missense probably benign 0.08
R7198:Olfr1256 UTSW 2 89835732 missense probably damaging 1.00
R7862:Olfr1256 UTSW 2 89835124 missense probably benign 0.16
R8100:Olfr1256 UTSW 2 89835685 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATACATCGGGGATCCCAGG -3'
(R):5'- CAGGTTCCACTCCAGACTTC -3'

Sequencing Primer
(F):5'- ATCCCAGGGCCTTGCTG -3'
(R):5'- GTTCCACTCCAGACTTCATGCAC -3'
Posted On2015-01-23