Incidental Mutation 'R2881:Gm340'
ID260335
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission 040469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2881 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41583049 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 227 (E227G)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect probably damaging
Transcript: ENSMUST00000172371
AA Change: E227G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: E227G

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,270 C385S probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Camta2 A T 11: 70,679,664 probably null Het
Ces1d C A 8: 93,195,031 G35W probably damaging Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Coasy G A 11: 101,085,849 V482I possibly damaging Het
Cyp2j9 A T 4: 96,574,012 V344E probably damaging Het
Dhx30 A T 9: 110,098,845 Y73* probably null Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Faap100 T C 11: 120,374,359 T564A probably damaging Het
Galc A G 12: 98,213,096 M518T probably benign Het
Gm15448 T A 7: 3,825,641 M1L probably null Het
Gpatch8 A G 11: 102,479,917 Y932H unknown Het
Hace1 T A 10: 45,671,134 M471K probably benign Het
Irf2bpl T A 12: 86,882,777 D374V probably damaging Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Olfr1256 T C 2: 89,844,984 probably null Het
Olfr206 A T 16: 59,344,852 L283Q probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Sgo2b T C 8: 63,927,536 Y754C probably damaging Het
She T A 3: 89,831,924 C141S probably benign Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Vmn2r88 G T 14: 51,418,689 C794F probably damaging Het
Zfp871 T C 17: 32,775,433 K256R probably damaging Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R7926:Gm340 UTSW 19 41582569 missense probably benign
R8164:Gm340 UTSW 19 41585410 missense probably damaging 1.00
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8323:Gm340 UTSW 19 41583597 missense probably benign 0.01
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
R8423:Gm340 UTSW 19 41585449 missense possibly damaging 0.95
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAATAACAGAATGCCACTTTGAG -3'
(R):5'- GCTGTAGGAAGTTGTGCACC -3'

Sequencing Primer
(F):5'- GAATCAAAGATCCATACTGTCTTCTC -3'
(R):5'- CTGCACATCTGCTGTAGGAAG -3'
Posted On2015-01-23