Incidental Mutation 'R2882:Olfr348'
ID260338
Institutional Source Beutler Lab
Gene Symbol Olfr348
Ensembl Gene ENSMUSG00000049315
Gene Nameolfactory receptor 348
SynonymsGA_x6K02T2NLDC-33481050-33481991, MOR136-8
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36784276-36789998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36787190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 222 (I222F)
Ref Sequence ENSEMBL: ENSMUSP00000150343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056865] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect probably damaging
Transcript: ENSMUST00000056865
AA Change: I222F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054037
Gene: ENSMUSG00000049315
AA Change: I222F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112950
AA Change: I222F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: I222F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213498
AA Change: I222F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214909
AA Change: I222F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215199
AA Change: I222F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216753
Predicted Effect probably benign
Transcript: ENSMUST00000217041
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Olfr348
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr348 APN 2 36787355 missense probably benign 0.03
IGL01943:Olfr348 APN 2 36787083 missense probably benign 0.13
IGL02030:Olfr348 APN 2 36787398 missense probably damaging 1.00
IGL02338:Olfr348 APN 2 36786545 nonsense probably null
IGL02349:Olfr348 APN 2 36787046 missense possibly damaging 0.95
IGL02695:Olfr348 APN 2 36787320 missense possibly damaging 0.72
IGL03004:Olfr348 APN 2 36787182 missense probably damaging 1.00
IGL03007:Olfr348 APN 2 36786800 missense probably damaging 0.99
IGL03024:Olfr348 APN 2 36786846 missense possibly damaging 0.55
R0360:Olfr348 UTSW 2 36787440 missense probably benign 0.03
R0388:Olfr348 UTSW 2 36786862 missense probably benign 0.43
R0614:Olfr348 UTSW 2 36786693 missense probably damaging 1.00
R1498:Olfr348 UTSW 2 36787346 missense probably damaging 1.00
R1562:Olfr348 UTSW 2 36786684 missense probably damaging 1.00
R3731:Olfr348 UTSW 2 36786566 missense possibly damaging 0.53
R4513:Olfr348 UTSW 2 36786770 missense probably benign 0.05
R4899:Olfr348 UTSW 2 36786798 missense probably benign 0.04
R5005:Olfr348 UTSW 2 36787358 missense probably benign
R5035:Olfr348 UTSW 2 36786891 missense probably damaging 1.00
R5490:Olfr348 UTSW 2 36787181 missense probably damaging 1.00
R6361:Olfr348 UTSW 2 36786780 missense probably damaging 1.00
R7762:Olfr348 UTSW 2 36787010 missense probably benign 0.03
R8109:Olfr348 UTSW 2 36786606 missense probably benign 0.00
R8223:Olfr348 UTSW 2 36787397 missense
Predicted Primers PCR Primer
(F):5'- ATCATTTGCTGGTGCCCTTG -3'
(R):5'- GGATTCAACATGGGTGTGACC -3'

Sequencing Primer
(F):5'- TGGTGCCCTTGTGCACAC -3'
(R):5'- GGTGTGACCATAGTGTACATCAC -3'
Posted On2015-01-23