Incidental Mutation 'R2882:Dcaf17'
ID260339
Institutional Source Beutler Lab
Gene Symbol Dcaf17
Ensembl Gene ENSMUSG00000041966
Gene NameDDB1 and CUL4 associated factor 17
Synonyms
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71055328-71099142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71082027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 319 (I319V)
Ref Sequence ENSEMBL: ENSMUSP00000120016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064141] [ENSMUST00000102701] [ENSMUST00000112159] [ENSMUST00000112167] [ENSMUST00000135357] [ENSMUST00000154704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064141
AA Change: I319V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000102701
AA Change: I319V

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000112159
AA Change: I283M

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000112167
Predicted Effect unknown
Transcript: ENSMUST00000130292
AA Change: I333V
SMART Domains Protein: ENSMUSP00000117830
Gene: ENSMUSG00000041966
AA Change: I333V

DomainStartEndE-ValueType
Pfam:DCAF17 55 405 6.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132619
Predicted Effect probably benign
Transcript: ENSMUST00000135357
SMART Domains Protein: ENSMUSP00000118011
Gene: ENSMUSG00000041966

DomainStartEndE-ValueType
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136299
Predicted Effect possibly damaging
Transcript: ENSMUST00000154704
AA Change: I319V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Dcaf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dcaf17 APN 2 71078159 missense probably benign 0.03
IGL01125:Dcaf17 APN 2 71089805 missense probably benign 0.03
IGL01761:Dcaf17 APN 2 71056537 missense probably damaging 1.00
IGL02641:Dcaf17 APN 2 71082031 missense probably damaging 1.00
R0081:Dcaf17 UTSW 2 71078468 splice site probably benign
R0388:Dcaf17 UTSW 2 71078571 missense probably benign 0.02
R0593:Dcaf17 UTSW 2 71087400 critical splice donor site probably null
R0637:Dcaf17 UTSW 2 71060419 missense probably damaging 0.99
R0661:Dcaf17 UTSW 2 71088435 missense probably damaging 1.00
R1281:Dcaf17 UTSW 2 71078156 missense probably damaging 1.00
R1454:Dcaf17 UTSW 2 71073173 missense probably damaging 1.00
R1501:Dcaf17 UTSW 2 71081988 missense probably damaging 1.00
R1908:Dcaf17 UTSW 2 71060369 nonsense probably null
R1919:Dcaf17 UTSW 2 71078172 splice site probably null
R4585:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R4586:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R6093:Dcaf17 UTSW 2 71082012 missense possibly damaging 0.51
R7070:Dcaf17 UTSW 2 71088513 missense probably benign 0.00
R8289:Dcaf17 UTSW 2 71055374 missense
R8418:Dcaf17 UTSW 2 71088373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTCCAACCAGAATGAG -3'
(R):5'- CTGGGTGACAAAACACTATTTCCTG -3'

Sequencing Primer
(F):5'- AGATTGGAGGCCATCCTT -3'
(R):5'- TCACAAATGCTGGGTGTGG -3'
Posted On2015-01-23