Mutagenetix > Incidental Mutations

Incidental Mutation 'R2882:Tgm6'

260340

Institutional Source

Beutler Lab

Gene Symbol

Tgm6

Ensembl Gene

ENSMUSG00000027403

Gene Name

transglutaminase 6

Synonyms

TGM3L

MMRRC Submission

040470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2882 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130112416-130154232 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130137439 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 163 (V163A)

Ref Sequence

ENSEMBL: ENSMUSP00000028888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028888]

Predicted Effect

probably benign
Transcript: ENSMUST00000028888
AA Change: V163A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	119	3e-31	PFAM
TGc	266	359	3.48e-40	SMART
low complexity region	466	483	N/A	INTRINSIC
Pfam:Transglut_C	495	600	2.4e-23	PFAM
Pfam:Transglut_C	607	704	4.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147616

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	A	13: 59,742,943	Q354H	probably benign	Het
AF529169	C	T	9: 89,602,802	V181I	possibly damaging	Het
Atp9a	T	C	2: 168,706,214	Y7C	probably damaging	Het
Atxn3	C	A	12: 101,937,411	L178F	probably damaging	Het
Cep112	T	C	11: 108,519,212	S211P	possibly damaging	Het
Csl	A	G	10: 99,758,925	F93L	probably damaging	Het
Cyp4f40	A	G	17: 32,668,073	I173V	probably benign	Het
Dcaf17	A	G	2: 71,082,027	I319V	possibly damaging	Het
Dock5	T	C	14: 67,839,620	Y258C	probably damaging	Het
Dpp10	T	C	1: 123,445,203	E236G	probably damaging	Het
Dpyd	A	G	3: 119,065,030	D631G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Fat2	C	A	11: 55,311,305	L314F	probably damaging	Het
Gsdmc	T	C	15: 63,779,795	I259V	probably benign	Het
Hydin	C	T	8: 110,566,923	L3501F	possibly damaging	Het
Kdm2a	A	G	19: 4,331,184		probably null	Het
Klra1	A	T	6: 130,377,863		probably null	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Mlh3	A	T	12: 85,267,566	H615Q	probably damaging	Het
Mmp12	A	G	9: 7,358,236	Y374C	probably damaging	Het
Mpp2	T	C	11: 102,064,633	E97G	probably benign	Het
Oasl2	C	T	5: 114,911,023	R175C	probably damaging	Het
Olfr348	A	T	2: 36,787,190	I222F	probably damaging	Het
Pcdhac2	A	T	18: 37,145,812	Q615L	probably damaging	Het
Ppm1h	T	A	10: 122,941,334	Y502N	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tlr5	C	T	1: 182,973,893	T240M	probably damaging	Het
Washc4	T	C	10: 83,579,501	I785T	possibly damaging	Het

Other mutations in Tgm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Tgm6	APN	2	130136495	missense	probably benign	0.00
IGL01331:Tgm6	APN	2	130143618	splice site	probably null
IGL01348:Tgm6	APN	2	130137379	missense	probably damaging	1.00
IGL01787:Tgm6	APN	2	130151434	splice site	probably benign
IGL02208:Tgm6	APN	2	130135870	missense	probably benign	0.11
IGL02656:Tgm6	APN	2	130145103	missense	probably damaging	1.00
IGL03280:Tgm6	APN	2	130138931	missense	probably damaging	1.00
R0200:Tgm6	UTSW	2	130152945	splice site	probably null
R0507:Tgm6	UTSW	2	130138831	missense	possibly damaging	0.56
R0744:Tgm6	UTSW	2	130151761	missense	probably benign	0.00
R0800:Tgm6	UTSW	2	130143422	missense	possibly damaging	0.94
R1530:Tgm6	UTSW	2	130151282	missense	possibly damaging	0.71
R1573:Tgm6	UTSW	2	130151740	missense	probably benign	0.00
R1706:Tgm6	UTSW	2	130145159	missense	possibly damaging	0.53
R2330:Tgm6	UTSW	2	130143242	missense	probably damaging	1.00
R2881:Tgm6	UTSW	2	130137439	missense	probably benign	0.04
R3622:Tgm6	UTSW	2	130151761	missense	possibly damaging	0.86
R3624:Tgm6	UTSW	2	130151761	missense	possibly damaging	0.86
R4370:Tgm6	UTSW	2	130143605	missense	probably benign	0.12
R4664:Tgm6	UTSW	2	130137394	missense	probably benign	0.05
R4664:Tgm6	UTSW	2	130141208	missense	probably benign	0.34
R4983:Tgm6	UTSW	2	130141193	missense	probably damaging	0.99
R5182:Tgm6	UTSW	2	130141302	missense	probably damaging	0.98
R5397:Tgm6	UTSW	2	130141908	missense	possibly damaging	0.90
R5411:Tgm6	UTSW	2	130145196	missense	probably benign	0.01
R5683:Tgm6	UTSW	2	130138955	missense	probably damaging	1.00
R5933:Tgm6	UTSW	2	130141256	missense	probably damaging	1.00
R6016:Tgm6	UTSW	2	130141228	missense	probably damaging	0.99
R7252:Tgm6	UTSW	2	130144964	missense	probably damaging	1.00
R7290:Tgm6	UTSW	2	130141190	missense	probably damaging	1.00
R7581:Tgm6	UTSW	2	130141285	missense	probably damaging	1.00
R8143:Tgm6	UTSW	2	130141843	missense	probably damaging	0.98
R8153:Tgm6	UTSW	2	130145055	missense	probably benign	0.00
R8219:Tgm6	UTSW	2	130151280	missense	probably benign
R8297:Tgm6	UTSW	2	130137438	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGATTCTAGGGGTTAGGTCC -3'
(R):5'- TGCCTTAAGAGTTGGCCCAG -3'

Sequencing Primer
(F):5'- TCCTGCTTGGGGGAAAAACTATCC -3'
(R):5'- AAGAGTTGGCCCAGGTTGC -3'

Posted On

2015-01-23