Mutagenetix > Incidental Mutations

Incidental Mutation 'R2882:Oasl2'

260344

Institutional Source

Beutler Lab

Gene Symbol

Oasl2

Ensembl Gene

ENSMUSG00000029561

Gene Name

2'-5' oligoadenylate synthetase-like 2

Synonyms

Mmu-OASL, M1204

MMRRC Submission

040470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2882 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114896936-114912234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 114911023 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 175 (R175C)

Ref Sequence

ENSEMBL: ENSMUSP00000115070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031542
AA Change: R395C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561
AA Change: R395C

Domain	Start	End	E-Value	Type
low complexity region	63	73	N/A	INTRINSIC
Pfam:OAS1_C	169	351	8.4e-77	PFAM
SCOP:d1euvb_	355	427	4e-4	SMART
Blast:UBQ	355	430	9e-30	BLAST
UBQ	435	506	8.88e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124716
AA Change: R175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561
AA Change: R175C

Domain	Start	End	E-Value	Type
Pfam:OAS1_C	1	131	1.2e-48	PFAM
SCOP:d1euvb_	135	207	6e-5	SMART
Blast:UBQ	135	210	9e-32	BLAST
Blast:UBQ	215	240	5e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129707

Predicted Effect

probably benign
Transcript: ENSMUST00000144064

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	A	13: 59,742,943	Q354H	probably benign	Het
AF529169	C	T	9: 89,602,802	V181I	possibly damaging	Het
Atp9a	T	C	2: 168,706,214	Y7C	probably damaging	Het
Atxn3	C	A	12: 101,937,411	L178F	probably damaging	Het
Cep112	T	C	11: 108,519,212	S211P	possibly damaging	Het
Csl	A	G	10: 99,758,925	F93L	probably damaging	Het
Cyp4f40	A	G	17: 32,668,073	I173V	probably benign	Het
Dcaf17	A	G	2: 71,082,027	I319V	possibly damaging	Het
Dock5	T	C	14: 67,839,620	Y258C	probably damaging	Het
Dpp10	T	C	1: 123,445,203	E236G	probably damaging	Het
Dpyd	A	G	3: 119,065,030	D631G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Fat2	C	A	11: 55,311,305	L314F	probably damaging	Het
Gsdmc	T	C	15: 63,779,795	I259V	probably benign	Het
Hydin	C	T	8: 110,566,923	L3501F	possibly damaging	Het
Kdm2a	A	G	19: 4,331,184		probably null	Het
Klra1	A	T	6: 130,377,863		probably null	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Mlh3	A	T	12: 85,267,566	H615Q	probably damaging	Het
Mmp12	A	G	9: 7,358,236	Y374C	probably damaging	Het
Mpp2	T	C	11: 102,064,633	E97G	probably benign	Het
Olfr348	A	T	2: 36,787,190	I222F	probably damaging	Het
Pcdhac2	A	T	18: 37,145,812	Q615L	probably damaging	Het
Ppm1h	T	A	10: 122,941,334	Y502N	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tgm6	T	C	2: 130,137,439	V163A	probably benign	Het
Tlr5	C	T	1: 182,973,893	T240M	probably damaging	Het
Washc4	T	C	10: 83,579,501	I785T	possibly damaging	Het

Other mutations in Oasl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02054:Oasl2	APN	5	114897806	missense	probably damaging	1.00
IGL02649:Oasl2	APN	5	114897692	missense	probably damaging	1.00
IGL02810:Oasl2	APN	5	114897791	missense	probably damaging	1.00
IGL03153:Oasl2	APN	5	114901332	missense	probably benign	0.02
R0179:Oasl2	UTSW	5	114910912	missense	probably benign
R1318:Oasl2	UTSW	5	114901381	missense	probably benign	0.01
R1831:Oasl2	UTSW	5	114901306	missense	probably benign	0.00
R1941:Oasl2	UTSW	5	114911362	utr 3 prime	probably benign
R2068:Oasl2	UTSW	5	114911237	missense	probably benign	0.01
R2104:Oasl2	UTSW	5	114911002	nonsense	probably null
R2170:Oasl2	UTSW	5	114906800	missense	probably damaging	0.99
R2437:Oasl2	UTSW	5	114911296	missense	probably benign
R3960:Oasl2	UTSW	5	114905037	missense	probably benign	0.03
R3962:Oasl2	UTSW	5	114897747	missense	probably benign	0.01
R4609:Oasl2	UTSW	5	114899796	missense	possibly damaging	0.47
R4761:Oasl2	UTSW	5	114899775	missense	probably benign	0.00
R5242:Oasl2	UTSW	5	114905061	missense	possibly damaging	0.92
R5691:Oasl2	UTSW	5	114899767	missense	possibly damaging	0.93
R6594:Oasl2	UTSW	5	114906775	missense	probably benign	0.30
R7053:Oasl2	UTSW	5	114911230	missense	possibly damaging	0.82
R7062:Oasl2	UTSW	5	114911091	nonsense	probably null
R7688:Oasl2	UTSW	5	114897848	missense	probably benign	0.01
R7753:Oasl2	UTSW	5	114905057	missense	probably benign
R8026:Oasl2	UTSW	5	114902268	unclassified	probably benign
R8160:Oasl2	UTSW	5	114901286	unclassified	probably benign
R8479:Oasl2	UTSW	5	114897791	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCTCCCAGGTTGTCTTG -3'
(R):5'- ATGGTGAAAGGCTTGCTCTG -3'

Sequencing Primer
(F):5'- CCAGGTTGTCTTGGTAGATGATAAAC -3'
(R):5'- GGCTTGCTCTGGCCACC -3'

Posted On

2015-01-23