Incidental Mutation 'R2882:Oasl2'
ID260344
Institutional Source Beutler Lab
Gene Symbol Oasl2
Ensembl Gene ENSMUSG00000029561
Gene Name2'-5' oligoadenylate synthetase-like 2
SynonymsMmu-OASL, M1204
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114896936-114912234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114911023 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 175 (R175C)
Ref Sequence ENSEMBL: ENSMUSP00000115070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716]
Predicted Effect probably damaging
Transcript: ENSMUST00000031542
AA Change: R395C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561
AA Change: R395C

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Pfam:OAS1_C 169 351 8.4e-77 PFAM
SCOP:d1euvb_ 355 427 4e-4 SMART
Blast:UBQ 355 430 9e-30 BLAST
UBQ 435 506 8.88e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124716
AA Change: R175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561
AA Change: R175C

DomainStartEndE-ValueType
Pfam:OAS1_C 1 131 1.2e-48 PFAM
SCOP:d1euvb_ 135 207 6e-5 SMART
Blast:UBQ 135 210 9e-32 BLAST
Blast:UBQ 215 240 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129707
Predicted Effect probably benign
Transcript: ENSMUST00000144064
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Oasl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Oasl2 APN 5 114897806 missense probably damaging 1.00
IGL02649:Oasl2 APN 5 114897692 missense probably damaging 1.00
IGL02810:Oasl2 APN 5 114897791 missense probably damaging 1.00
IGL03153:Oasl2 APN 5 114901332 missense probably benign 0.02
R0179:Oasl2 UTSW 5 114910912 missense probably benign
R1318:Oasl2 UTSW 5 114901381 missense probably benign 0.01
R1831:Oasl2 UTSW 5 114901306 missense probably benign 0.00
R1941:Oasl2 UTSW 5 114911362 utr 3 prime probably benign
R2068:Oasl2 UTSW 5 114911237 missense probably benign 0.01
R2104:Oasl2 UTSW 5 114911002 nonsense probably null
R2170:Oasl2 UTSW 5 114906800 missense probably damaging 0.99
R2437:Oasl2 UTSW 5 114911296 missense probably benign
R3960:Oasl2 UTSW 5 114905037 missense probably benign 0.03
R3962:Oasl2 UTSW 5 114897747 missense probably benign 0.01
R4609:Oasl2 UTSW 5 114899796 missense possibly damaging 0.47
R4761:Oasl2 UTSW 5 114899775 missense probably benign 0.00
R5242:Oasl2 UTSW 5 114905061 missense possibly damaging 0.92
R5691:Oasl2 UTSW 5 114899767 missense possibly damaging 0.93
R6594:Oasl2 UTSW 5 114906775 missense probably benign 0.30
R7053:Oasl2 UTSW 5 114911230 missense possibly damaging 0.82
R7062:Oasl2 UTSW 5 114911091 nonsense probably null
R7688:Oasl2 UTSW 5 114897848 missense probably benign 0.01
R7753:Oasl2 UTSW 5 114905057 missense probably benign
R8026:Oasl2 UTSW 5 114902268 unclassified probably benign
R8160:Oasl2 UTSW 5 114901286 unclassified probably benign
R8479:Oasl2 UTSW 5 114897791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTCCCAGGTTGTCTTG -3'
(R):5'- ATGGTGAAAGGCTTGCTCTG -3'

Sequencing Primer
(F):5'- CCAGGTTGTCTTGGTAGATGATAAAC -3'
(R):5'- GGCTTGCTCTGGCCACC -3'
Posted On2015-01-23