Mutagenetix > Incidental Mutation

Incidental Mutation 'R2882:Klra1'

260345

Institutional Source

Beutler Lab

Gene Symbol

Klra1

Ensembl Gene

ENSMUSG00000079853

Gene Name

killer cell lectin-like receptor, subfamily A, member 1

Synonyms

Ly49o<129>, Ly49A

MMRRC Submission

040470-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R2882 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130363917-130386874 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 130377863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032288]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000032288

SMART Domains

Protein: ENSMUSP00000032288
Gene: ENSMUSG00000079853

Domain	Start	End	E-Value	Type
Blast:CLECT	73	118	9e-8	BLAST
CLECT	139	254	4.02e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127570

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	A	13: 59,742,943	Q354H	probably benign	Het
AF529169	C	T	9: 89,602,802	V181I	possibly damaging	Het
Atp9a	T	C	2: 168,706,214	Y7C	probably damaging	Het
Atxn3	C	A	12: 101,937,411	L178F	probably damaging	Het
Cep112	T	C	11: 108,519,212	S211P	possibly damaging	Het
Csl	A	G	10: 99,758,925	F93L	probably damaging	Het
Cyp4f40	A	G	17: 32,668,073	I173V	probably benign	Het
Dcaf17	A	G	2: 71,082,027	I319V	possibly damaging	Het
Dock5	T	C	14: 67,839,620	Y258C	probably damaging	Het
Dpp10	T	C	1: 123,445,203	E236G	probably damaging	Het
Dpyd	A	G	3: 119,065,030	D631G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Fat2	C	A	11: 55,311,305	L314F	probably damaging	Het
Gsdmc	T	C	15: 63,779,795	I259V	probably benign	Het
Hydin	C	T	8: 110,566,923	L3501F	possibly damaging	Het
Kdm2a	A	G	19: 4,331,184		probably null	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Mlh3	A	T	12: 85,267,566	H615Q	probably damaging	Het
Mmp12	A	G	9: 7,358,236	Y374C	probably damaging	Het
Mpp2	T	C	11: 102,064,633	E97G	probably benign	Het
Oasl2	C	T	5: 114,911,023	R175C	probably damaging	Het
Olfr348	A	T	2: 36,787,190	I222F	probably damaging	Het
Pcdhac2	A	T	18: 37,145,812	Q615L	probably damaging	Het
Ppm1h	T	A	10: 122,941,334	Y502N	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tgm6	T	C	2: 130,137,439	V163A	probably benign	Het
Tlr5	C	T	1: 182,973,893	T240M	probably damaging	Het
Washc4	T	C	10: 83,579,501	I785T	possibly damaging	Het

Other mutations in Klra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01132:Klra1	APN	6	130364274	nonsense	probably null
IGL01320:Klra1	APN	6	130364261	missense	probably benign	0.02
IGL01322:Klra1	APN	6	130364261	missense	probably benign	0.02
IGL02149:Klra1	APN	6	130375330	missense	probably damaging	1.00
IGL02666:Klra1	APN	6	130364315	missense	probably damaging	1.00
IGL02895:Klra1	APN	6	130375240	missense	possibly damaging	0.51
R0004:Klra1	UTSW	6	130372873	missense	probably damaging	1.00
R0408:Klra1	UTSW	6	130377774	missense	probably benign	0.13
R0442:Klra1	UTSW	6	130372872	missense	probably damaging	1.00
R0498:Klra1	UTSW	6	130372819	critical splice donor site	probably null
R0765:Klra1	UTSW	6	130379092	splice site	probably benign
R1761:Klra1	UTSW	6	130372873	missense	probably damaging	1.00
R1922:Klra1	UTSW	6	130372865	missense	probably benign	0.01
R1987:Klra1	UTSW	6	130377779	missense	probably benign
R5054:Klra1	UTSW	6	130375284	missense	probably damaging	0.99
R5190:Klra1	UTSW	6	130375278	missense	probably damaging	1.00
R5572:Klra1	UTSW	6	130372839	missense	possibly damaging	0.73
R5825:Klra1	UTSW	6	130380629	missense	probably damaging	1.00
R6784:Klra1	UTSW	6	130372854	missense	probably benign	0.00
R8957:Klra1	UTSW	6	130380646	missense	possibly damaging	0.89
R9154:Klra1	UTSW	6	130380644	missense
Z1176:Klra1	UTSW	6	130372851	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AATCTGTTCTGATCCCTGTTGAGG -3'
(R):5'- AGGTGGATATCTTGCATTCCATATG -3'

Sequencing Primer
(F):5'- TTGAGGGATTCCAGAAGATCACACTC -3'
(R):5'- CTACCACCATTTTATTCAGC -3'

Posted On

2015-01-23