Incidental Mutation 'R2882:Klra1'
ID260345
Institutional Source Beutler Lab
Gene Symbol Klra1
Ensembl Gene ENSMUSG00000079853
Gene Namekiller cell lectin-like receptor, subfamily A, member 1
SynonymsLy49o<129>, Ly49A
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location130363917-130386874 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 130377863 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032288]
Predicted Effect probably null
Transcript: ENSMUST00000032288
SMART Domains Protein: ENSMUSP00000032288
Gene: ENSMUSG00000079853

DomainStartEndE-ValueType
Blast:CLECT 73 118 9e-8 BLAST
CLECT 139 254 4.02e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Klra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Klra1 APN 6 130364274 nonsense probably null
IGL01320:Klra1 APN 6 130364261 missense probably benign 0.02
IGL01322:Klra1 APN 6 130364261 missense probably benign 0.02
IGL02149:Klra1 APN 6 130375330 missense probably damaging 1.00
IGL02666:Klra1 APN 6 130364315 missense probably damaging 1.00
IGL02895:Klra1 APN 6 130375240 missense possibly damaging 0.51
R0004:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R0408:Klra1 UTSW 6 130377774 missense probably benign 0.13
R0442:Klra1 UTSW 6 130372872 missense probably damaging 1.00
R0498:Klra1 UTSW 6 130372819 critical splice donor site probably null
R0765:Klra1 UTSW 6 130379092 splice site probably benign
R1761:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R1922:Klra1 UTSW 6 130372865 missense probably benign 0.01
R1987:Klra1 UTSW 6 130377779 missense probably benign
R5054:Klra1 UTSW 6 130375284 missense probably damaging 0.99
R5190:Klra1 UTSW 6 130375278 missense probably damaging 1.00
R5572:Klra1 UTSW 6 130372839 missense possibly damaging 0.73
R5825:Klra1 UTSW 6 130380629 missense probably damaging 1.00
R6784:Klra1 UTSW 6 130372854 missense probably benign 0.00
Z1176:Klra1 UTSW 6 130372851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTGTTCTGATCCCTGTTGAGG -3'
(R):5'- AGGTGGATATCTTGCATTCCATATG -3'

Sequencing Primer
(F):5'- TTGAGGGATTCCAGAAGATCACACTC -3'
(R):5'- CTACCACCATTTTATTCAGC -3'
Posted On2015-01-23