Incidental Mutation 'R2882:Slc5a11'
ID260346
Institutional Source Beutler Lab
Gene Symbol Slc5a11
Ensembl Gene ENSMUSG00000030769
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 11
Synonyms2010013B02Rik, Kst1
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2882 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location123214780-123273253 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGTGC to G at 123239372 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033035] [ENSMUST00000127655] [ENSMUST00000131461] [ENSMUST00000131933] [ENSMUST00000167299]
Predicted Effect probably null
Transcript: ENSMUST00000033035
SMART Domains Protein: ENSMUSP00000033035
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 487 2.2e-143 PFAM
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 653 672 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127655
SMART Domains Protein: ENSMUSP00000117956
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 152 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131209
SMART Domains Protein: ENSMUSP00000120678
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
Pfam:SSF 7 72 8.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131461
SMART Domains Protein: ENSMUSP00000123027
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131933
SMART Domains Protein: ENSMUSP00000121459
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 402 1.2e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167299
SMART Domains Protein: ENSMUSP00000127977
Gene: ENSMUSG00000030769

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:SSF 58 487 2.2e-143 PFAM
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 653 672 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cotransporters, such as SLC5A11, represent a major class of proteins that make use of ion gradients to drive active transport for the cellular accumulation of nutrients, neurotransmitters, osmolytes, and ions Roll et al. (2002) [PubMed 12039040].[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Slc5a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Slc5a11 APN 7 123250174 missense probably null 0.72
IGL01670:Slc5a11 APN 7 123269949 missense probably benign
IGL01960:Slc5a11 APN 7 123269940 missense probably benign 0.00
IGL02512:Slc5a11 APN 7 123265255 missense probably damaging 0.96
IGL02637:Slc5a11 APN 7 123260505 critical splice acceptor site probably null
IGL02680:Slc5a11 APN 7 123265631 missense probably damaging 1.00
IGL03185:Slc5a11 APN 7 123265189 missense possibly damaging 0.61
R0454:Slc5a11 UTSW 7 123265235 missense possibly damaging 0.83
R0894:Slc5a11 UTSW 7 123258420 missense possibly damaging 0.91
R1501:Slc5a11 UTSW 7 123260508 missense probably damaging 1.00
R1879:Slc5a11 UTSW 7 123239448 missense possibly damaging 0.91
R2185:Slc5a11 UTSW 7 123273198 missense probably damaging 0.96
R2880:Slc5a11 UTSW 7 123239372 frame shift probably null
R2919:Slc5a11 UTSW 7 123239372 frame shift probably null
R3012:Slc5a11 UTSW 7 123239372 frame shift probably null
R4307:Slc5a11 UTSW 7 123269870 missense probably benign 0.01
R4405:Slc5a11 UTSW 7 123258477 missense probably damaging 1.00
R4510:Slc5a11 UTSW 7 123235635 missense probably benign 0.05
R4511:Slc5a11 UTSW 7 123235635 missense probably benign 0.05
R4599:Slc5a11 UTSW 7 123258378 missense probably benign 0.00
R4660:Slc5a11 UTSW 7 123265263 missense probably damaging 1.00
R5822:Slc5a11 UTSW 7 123252431 missense probably damaging 1.00
R6641:Slc5a11 UTSW 7 123238155 missense probably benign 0.01
R6694:Slc5a11 UTSW 7 123267789 missense possibly damaging 0.65
R7078:Slc5a11 UTSW 7 123258446 missense probably damaging 1.00
R7580:Slc5a11 UTSW 7 123265198 missense probably damaging 1.00
R8088:Slc5a11 UTSW 7 123265728 missense probably benign 0.14
R8139:Slc5a11 UTSW 7 123269976 missense probably benign 0.00
R8302:Slc5a11 UTSW 7 123247939 missense probably damaging 1.00
Z1177:Slc5a11 UTSW 7 123239390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAGACACTTTCTCAAG -3'
(R):5'- GAAGCCTCCTGTTTGCTTAACG -3'

Sequencing Primer
(F):5'- GCAGACACTTTCTCAAGTTGTG -3'
(R):5'- GCCTCCTGTTTGCTTAACGAAAAG -3'
Posted On2015-01-23