Incidental Mutation 'R2882:Mmp12'
ID260349
Institutional Source Beutler Lab
Gene Symbol Mmp12
Ensembl Gene ENSMUSG00000049723
Gene Namematrix metallopeptidase 12
SynonymsMmel, macrophage elastase, MMP12
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7344381-7369499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7358236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 374 (Y374C)
Ref Sequence ENSEMBL: ENSMUSP00000114129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005950] [ENSMUST00000065079] [ENSMUST00000120655] [ENSMUST00000127722]
Predicted Effect probably damaging
Transcript: ENSMUST00000005950
AA Change: Y444C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005950
Gene: ENSMUSG00000049723
AA Change: Y444C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PG_binding_1 30 91 7.6e-22 PFAM
ZnMc 109 268 2.76e-57 SMART
low complexity region 269 284 N/A INTRINSIC
HX 292 334 1.44e-6 SMART
HX 336 379 2.03e-6 SMART
HX 384 431 2.29e-14 SMART
HX 433 473 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065079
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120655
AA Change: Y374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114129
Gene: ENSMUSG00000049723
AA Change: Y374C

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 9.1e-9 PFAM
ZnMc 39 198 2.76e-57 SMART
low complexity region 199 214 N/A INTRINSIC
HX 222 264 1.44e-6 SMART
HX 266 309 2.03e-6 SMART
HX 314 361 2.29e-14 SMART
HX 363 403 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127722
SMART Domains Protein: ENSMUSP00000120225
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148005
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein have a diminished capacity to degrade extracellular matrix components, do not develop emphysema in response to long-term exposure to cigarette smoke, and exhibit impaired clearance and increased mortality upon bacterial infection. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to cigarette smoke, decreased littler size, abnormal myelination, abnormal macrophage physiology, and decreased oligodedrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Mmp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mmp12 APN 9 7358307 missense possibly damaging 0.57
IGL03047:Mmp12 APN 9 7357797 splice site probably benign
IGL03224:Mmp12 APN 9 7350002 unclassified probably benign
IGL03247:Mmp12 APN 9 7348631 missense probably benign 0.05
R0050:Mmp12 UTSW 9 7350152 unclassified probably benign
R0480:Mmp12 UTSW 9 7350016 missense probably damaging 1.00
R0729:Mmp12 UTSW 9 7358290 missense possibly damaging 0.82
R0800:Mmp12 UTSW 9 7357827 missense possibly damaging 0.74
R1114:Mmp12 UTSW 9 7358289 missense possibly damaging 0.69
R1441:Mmp12 UTSW 9 7354787 missense probably damaging 0.98
R1765:Mmp12 UTSW 9 7354772 missense probably damaging 1.00
R2071:Mmp12 UTSW 9 7349725 missense probably damaging 1.00
R2102:Mmp12 UTSW 9 7349802 missense probably damaging 1.00
R2936:Mmp12 UTSW 9 7357819 missense probably benign
R4645:Mmp12 UTSW 9 7347515 missense probably benign 0.04
R5210:Mmp12 UTSW 9 7349729 nonsense probably null
R5499:Mmp12 UTSW 9 7353000 missense probably benign 0.02
R5774:Mmp12 UTSW 9 7354823 missense possibly damaging 0.84
R5778:Mmp12 UTSW 9 7350106 missense probably damaging 1.00
R5841:Mmp12 UTSW 9 7347501 missense possibly damaging 0.93
R5869:Mmp12 UTSW 9 7348446 intron probably benign
R6044:Mmp12 UTSW 9 7350050 missense possibly damaging 0.94
R6494:Mmp12 UTSW 9 7353479 missense probably damaging 0.99
R6651:Mmp12 UTSW 9 7355345 missense possibly damaging 0.62
R7057:Mmp12 UTSW 9 7357840 missense probably damaging 1.00
R7057:Mmp12 UTSW 9 7369173 missense probably benign 0.33
X0062:Mmp12 UTSW 9 7353013 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGCCTGAGAAAAGTTGCC -3'
(R):5'- GCCACATAGTTACACCCTGAGC -3'

Sequencing Primer
(F):5'- GAAAAGTTGCCTGTCAGTGTCAC -3'
(R):5'- CATAGTTACACCCTGAGCATAGAGTG -3'
Posted On2015-01-23