Incidental Mutation 'R2882:Washc4'
ID260351
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83579501 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 785 (I785T)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038388
AA Change: I785T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: I785T

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7900:Washc4 UTSW 10 83573773 splice site probably null
R8491:Washc4 UTSW 10 83576123 missense probably benign 0.24
R8791:Washc4 UTSW 10 83550884 missense probably benign 0.08
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTCAAGGAGGTGATTCCGG -3'
(R):5'- ACGTTCTCATTTACAGCTTTAGCCG -3'

Sequencing Primer
(F):5'- AGGTGATTCCGGCTGTGTAAG -3'
(R):5'- TTCTAGGGCAGTCAGGACTAC -3'
Posted On2015-01-23