Incidental Mutation 'R2882:Csl'
ID260352
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99758925 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 93 (F93L)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure
Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056085
AA Change: F93L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: F93L

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222959
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2284:Csl UTSW 10 99758459 missense possibly damaging 0.84
R4128:Csl UTSW 10 99758600 missense probably benign 0.02
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R5700:Csl UTSW 10 99759015 missense probably damaging 0.97
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8064:Csl UTSW 10 99758545 missense probably damaging 1.00
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAATTGTCCAGCATGGTGAC -3'
(R):5'- CCAGTGCTTCTTCCACGAAC -3'

Sequencing Primer
(F):5'- TCCAGCATGGTGACGACATG -3'
(R):5'- CTTCTTCCACGAACTTGAAAGACGTG -3'
Posted On2015-01-23