Incidental Mutation 'R2882:Ppm1h'
ID260353
Institutional Source Beutler Lab
Gene Symbol Ppm1h
Ensembl Gene ENSMUSG00000034613
Gene Nameprotein phosphatase 1H (PP2C domain containing)
SynonymsARHCL1, A430075L18Rik, C030002B11Rik
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location122678762-122945795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122941334 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 502 (Y502N)
Ref Sequence ENSEMBL: ENSMUSP00000066561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067918] [ENSMUST00000162969]
Predicted Effect probably damaging
Transcript: ENSMUST00000067918
AA Change: Y502N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066561
Gene: ENSMUSG00000034613
AA Change: Y502N

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 504 1.22e-35 SMART
PP2C_SIG 136 506 1.59e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161065
Predicted Effect possibly damaging
Transcript: ENSMUST00000162969
AA Change: Y121N

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124006
Gene: ENSMUSG00000034613
AA Change: Y121N

DomainStartEndE-ValueType
Pfam:PP2C 2 99 2.9e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Ppm1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Ppm1h APN 10 122878629 critical splice donor site probably null
IGL01060:Ppm1h APN 10 122907571 missense possibly damaging 0.49
IGL01557:Ppm1h APN 10 122782181 critical splice acceptor site probably null
IGL01608:Ppm1h APN 10 122941280 nonsense probably null
IGL02112:Ppm1h APN 10 122802400 missense possibly damaging 0.86
R0129:Ppm1h UTSW 10 122941355 missense probably damaging 0.97
R0217:Ppm1h UTSW 10 122920735 missense probably damaging 1.00
R0309:Ppm1h UTSW 10 122920782 missense probably damaging 1.00
R0455:Ppm1h UTSW 10 122802324 missense probably benign 0.00
R1144:Ppm1h UTSW 10 122941278 missense probably benign 0.01
R1430:Ppm1h UTSW 10 122857099 missense probably damaging 1.00
R2014:Ppm1h UTSW 10 122920725 missense possibly damaging 0.79
R2021:Ppm1h UTSW 10 122878528 nonsense probably null
R3767:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3768:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3770:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R4816:Ppm1h UTSW 10 122679379 missense possibly damaging 0.89
R4996:Ppm1h UTSW 10 122941340 missense probably damaging 1.00
R5640:Ppm1h UTSW 10 122782278 missense probably benign 0.30
R6199:Ppm1h UTSW 10 122920739 missense probably damaging 1.00
R7759:Ppm1h UTSW 10 122904113 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTGTGACCATAGTGATGC -3'
(R):5'- AAAACCAGAGAGGCCTTTGG -3'

Sequencing Primer
(F):5'- GTGTGACCATAGTGATGCTTCCTTTC -3'
(R):5'- TTTGGGCAGCAAACTCCC -3'
Posted On2015-01-23