Incidental Mutation 'R2882:Ewsr1'
ID260354
Institutional Source Beutler Lab
Gene Symbol Ewsr1
Ensembl Gene ENSMUSG00000009079
Gene NameEwing sarcoma breakpoint region 1
SynonymsEws
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5069689-5099266 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 5078523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073308] [ENSMUST00000079949] [ENSMUST00000093365] [ENSMUST00000102930]
Predicted Effect unknown
Transcript: ENSMUST00000073308
AA Change: V334L
SMART Domains Protein: ENSMUSP00000073034
Gene: ENSMUSG00000009079
AA Change: V334L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 5.91e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 5.91e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
RRM 324 405 8.38e-17 SMART
low complexity region 416 475 N/A INTRINSIC
ZnF_RBZ 482 508 6.22e-7 SMART
low complexity region 512 586 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079949
AA Change: V371L
SMART Domains Protein: ENSMUSP00000078867
Gene: ENSMUSG00000009079
AA Change: V371L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.98e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.98e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 331 N/A INTRINSIC
low complexity region 335 356 N/A INTRINSIC
RRM 361 442 8.38e-17 SMART
low complexity region 453 512 N/A INTRINSIC
ZnF_RBZ 519 545 6.22e-7 SMART
low complexity region 549 623 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093365
SMART Domains Protein: ENSMUSP00000091057
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.29e-5 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.29e-5 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000102930
AA Change: V377L
SMART Domains Protein: ENSMUSP00000099994
Gene: ENSMUSG00000009079
AA Change: V377L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 3.23e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 97 127 N/A INTRINSIC
internal_repeat_1 161 176 3.23e-6 PROSPERO
low complexity region 193 217 N/A INTRINSIC
low complexity region 219 272 N/A INTRINSIC
low complexity region 306 337 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
RRM 367 448 8.38e-17 SMART
low complexity region 459 518 N/A INTRINSIC
ZnF_RBZ 525 551 6.22e-7 SMART
low complexity region 555 629 N/A INTRINSIC
low complexity region 635 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151497
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, defective pre-B cell development, apoptosis of gametes and arrest in gamete maturation due to reduced meiotic recombination leading to infertility, kyphosis, lymphopenia, muscular atrophy, and hypersensitivity to ionizing radiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Ewsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ewsr1 APN 11 5088077 missense probably damaging 1.00
IGL02218:Ewsr1 APN 11 5070668 missense unknown
IGL02288:Ewsr1 APN 11 5093689 missense possibly damaging 0.53
IGL02410:Ewsr1 APN 11 5093863 splice site probably benign
R0485:Ewsr1 UTSW 11 5070737 splice site probably benign
R0570:Ewsr1 UTSW 11 5085935 missense possibly damaging 0.80
R1546:Ewsr1 UTSW 11 5078574 unclassified probably benign
R1688:Ewsr1 UTSW 11 5072870 missense unknown
R2074:Ewsr1 UTSW 11 5071555 missense unknown
R2158:Ewsr1 UTSW 11 5091450 splice site probably benign
R2326:Ewsr1 UTSW 11 5091857 critical splice donor site probably null
R2880:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2881:Ewsr1 UTSW 11 5078523 unclassified probably benign
R3965:Ewsr1 UTSW 11 5083476 missense unknown
R4743:Ewsr1 UTSW 11 5083541 missense unknown
R4782:Ewsr1 UTSW 11 5070423 missense unknown
R5023:Ewsr1 UTSW 11 5088054 missense possibly damaging 0.83
R5194:Ewsr1 UTSW 11 5082355 missense unknown
R5422:Ewsr1 UTSW 11 5080668 intron probably benign
R5790:Ewsr1 UTSW 11 5082263 intron probably benign
R6993:Ewsr1 UTSW 11 5071573 missense probably benign 0.23
R7719:Ewsr1 UTSW 11 5085900 missense unknown
Predicted Primers PCR Primer
(F):5'- ACACAATCATCAGCTGCTTAGC -3'
(R):5'- CCGATTGGTTAAGAAGCCCC -3'

Sequencing Primer
(F):5'- GCCAGAATGCATGAGATCTTGTC -3'
(R):5'- AGAAGCCCCTATTATTATCTAGGCC -3'
Posted On2015-01-23