Incidental Mutation 'R2882:Kremen1'
ID260355
Institutional Source Beutler Lab
Gene Symbol Kremen1
Ensembl Gene ENSMUSG00000020393
Gene Namekringle containing transmembrane protein 1
SynonymsKrm1
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2882 (G1)
Quality Score157
Status Not validated
Chromosome11
Chromosomal Location5191552-5261558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGGG to CGGGGGG at 5201791 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020662]
Predicted Effect probably benign
Transcript: ENSMUST00000020662
SMART Domains Protein: ENSMUSP00000020662
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KR 30 116 9.81e-23 SMART
Pfam:WSC 119 200 3.7e-21 PFAM
CUB 214 321 4.27e-19 SMART
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151978
SMART Domains Protein: ENSMUSP00000121252
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
Pfam:WSC 17 98 2.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Kremen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Kremen1 APN 11 5199667 missense probably benign 0.00
R0038:Kremen1 UTSW 11 5207703 splice site probably benign
R0511:Kremen1 UTSW 11 5215447 missense probably damaging 1.00
R1557:Kremen1 UTSW 11 5215373 splice site probably null
R1579:Kremen1 UTSW 11 5201791 unclassified probably benign
R1729:Kremen1 UTSW 11 5201791 unclassified probably benign
R1784:Kremen1 UTSW 11 5201792 unclassified probably benign
R1800:Kremen1 UTSW 11 5201791 unclassified probably benign
R2079:Kremen1 UTSW 11 5201794 frame shift probably null
R2100:Kremen1 UTSW 11 5201788 unclassified probably benign
R2286:Kremen1 UTSW 11 5201791 unclassified probably benign
R2298:Kremen1 UTSW 11 5201788 unclassified probably benign
R2352:Kremen1 UTSW 11 5201791 unclassified probably benign
R2512:Kremen1 UTSW 11 5201791 unclassified probably benign
R2761:Kremen1 UTSW 11 5201792 unclassified probably benign
R2846:Kremen1 UTSW 11 5201793 unclassified probably benign
R2944:Kremen1 UTSW 11 5201791 unclassified probably benign
R2980:Kremen1 UTSW 11 5201794 unclassified probably benign
R3151:Kremen1 UTSW 11 5195012 missense probably damaging 0.99
R3610:Kremen1 UTSW 11 5201791 unclassified probably benign
R3831:Kremen1 UTSW 11 5201794 unclassified probably benign
R3957:Kremen1 UTSW 11 5201791 unclassified probably benign
R4231:Kremen1 UTSW 11 5243881 nonsense probably null
R4397:Kremen1 UTSW 11 5199610 missense probably benign 0.36
R5627:Kremen1 UTSW 11 5199709 missense probably benign 0.01
R6818:Kremen1 UTSW 11 5195051 missense probably benign 0.02
R7584:Kremen1 UTSW 11 5194964 missense possibly damaging 0.95
T0975:Kremen1 UTSW 11 5195105 missense probably benign 0.02
Y4339:Kremen1 UTSW 11 5201791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGAAATGATCTGTAGCTGAGTC -3'
(R):5'- TGACTTCCCTGACACCTACG -3'

Sequencing Primer
(F):5'- TCAGGAGGACCAAGTGTGCC -3'
(R):5'- TGACACCTACGCCACTGG -3'
Posted On2015-01-23