Incidental Mutation 'R2882:Mpp2'
ID260357
Institutional Source Beutler Lab
Gene Symbol Mpp2
Ensembl Gene ENSMUSG00000017314
Gene Namemembrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
SynonymsDlg2, Dlgh2, Pals4, D11Bwg0652e
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102057015-102088515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102064633 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 97 (E97G)
Ref Sequence ENSEMBL: ENSMUSP00000097967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017458] [ENSMUST00000100398]
Predicted Effect probably benign
Transcript: ENSMUST00000017458
AA Change: E80G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017458
Gene: ENSMUSG00000017314
AA Change: E80G

DomainStartEndE-ValueType
L27 11 66 1.19e-11 SMART
L27 67 121 2.46e-13 SMART
PDZ 149 219 1.89e-10 SMART
SH3 228 292 9.77e-11 SMART
GuKc 349 540 6.55e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100398
AA Change: E97G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097967
Gene: ENSMUSG00000017314
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
L27 28 83 1.19e-11 SMART
L27 84 138 2.46e-13 SMART
PDZ 166 236 1.89e-10 SMART
SH3 245 309 9.77e-11 SMART
GuKc 366 557 6.55e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147126
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Palmitoylated membrane protein 2 is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. Palmitoylated membrane protein 2 contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Mpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Mpp2 APN 11 102063309 missense probably damaging 1.00
IGL01564:Mpp2 APN 11 102061519 missense probably benign 0.01
IGL02158:Mpp2 APN 11 102063262 missense probably benign 0.01
IGL02456:Mpp2 APN 11 102059373 missense possibly damaging 0.72
IGL03271:Mpp2 APN 11 102063423 splice site probably benign
R0488:Mpp2 UTSW 11 102061601 missense possibly damaging 0.64
R0512:Mpp2 UTSW 11 102062290 missense possibly damaging 0.64
R0960:Mpp2 UTSW 11 102061585 missense possibly damaging 0.80
R1572:Mpp2 UTSW 11 102060548 missense probably benign 0.07
R1740:Mpp2 UTSW 11 102062396 splice site probably null
R1867:Mpp2 UTSW 11 102064667 missense probably benign 0.09
R2133:Mpp2 UTSW 11 102064595 missense probably benign 0.01
R2277:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2279:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2313:Mpp2 UTSW 11 102062072 missense possibly damaging 0.77
R3429:Mpp2 UTSW 11 102085315 missense probably benign
R4719:Mpp2 UTSW 11 102064433 missense possibly damaging 0.93
R4959:Mpp2 UTSW 11 102063291 missense probably damaging 1.00
R4968:Mpp2 UTSW 11 102064298 missense probably benign 0.31
R5715:Mpp2 UTSW 11 102062261 missense probably damaging 1.00
R5778:Mpp2 UTSW 11 102064443 missense probably benign 0.06
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6045:Mpp2 UTSW 11 102059354 missense probably benign 0.05
R6275:Mpp2 UTSW 11 102060969 missense probably damaging 1.00
R6458:Mpp2 UTSW 11 102080769 missense probably benign 0.01
R6884:Mpp2 UTSW 11 102062078 missense probably benign 0.23
R6980:Mpp2 UTSW 11 102059328 missense probably damaging 1.00
R7699:Mpp2 UTSW 11 102059435 missense probably damaging 0.99
X0067:Mpp2 UTSW 11 102064385 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTGTCTCCAGGAGGGACTAAAG -3'
(R):5'- ACCCAGAGTGATGATGCAAG -3'

Sequencing Primer
(F):5'- TCCAGGAGGGACTAAAGGAGGG -3'
(R):5'- CAAGTGGGGTTTAGGGGCTTAGAG -3'
Posted On2015-01-23