Incidental Mutation 'R2882:Cep112'
ID260358
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Namecentrosomal protein 112
SynonymsMacoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location108425192-108860615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108519212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000114627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000133670] [ENSMUST00000138538] [ENSMUST00000150863] [ENSMUST00000182729]
Predicted Effect probably benign
Transcript: ENSMUST00000061287
AA Change: S485P

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: S485P

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130515
AA Change: S485P

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: S485P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133670
AA Change: S211P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728
AA Change: S211P

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
internal_repeat_2 66 104 4.9e-5 PROSPERO
internal_repeat_1 81 110 2.63e-5 PROSPERO
coiled coil region 123 203 N/A INTRINSIC
internal_repeat_3 252 264 4.9e-5 PROSPERO
low complexity region 317 328 N/A INTRINSIC
internal_repeat_2 332 370 4.9e-5 PROSPERO
internal_repeat_3 532 544 4.9e-5 PROSPERO
internal_repeat_1 540 569 2.63e-5 PROSPERO
coiled coil region 571 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138538
AA Change: S485P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728
AA Change: S485P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.7e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150863
AA Change: S537P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: S537P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182729
AA Change: S443P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: S443P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4407:Cep112 UTSW 11 108519201 missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R4977:Cep112 UTSW 11 108434236 missense probably damaging 0.97
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5560:Cep112 UTSW 11 108437235 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5857:Cep112 UTSW 11 108531471 splice site probably benign
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108855870 missense probably damaging 1.00
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
R7386:Cep112 UTSW 11 108808681 missense probably benign 0.00
R7539:Cep112 UTSW 11 108855828 missense probably benign 0.38
R8262:Cep112 UTSW 11 108503151 missense probably damaging 1.00
Z1176:Cep112 UTSW 11 108425310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGCGAGTGGGTTAGAC -3'
(R):5'- GCACCCTAGACAGCATAGTG -3'

Sequencing Primer
(F):5'- CTTATGATGTTCCTACCTAAGTGGG -3'
(R):5'- CCCTAGACAGCATAGTGTGTTTTGAC -3'
Posted On2015-01-23