Mutagenetix > Incidental Mutations

Incidental Mutation 'R2882:Mlh3'

260359

Institutional Source

Beutler Lab

Gene Symbol

Mlh3

Ensembl Gene

ENSMUSG00000021245

Gene Name

mutL homolog 3

Synonyms

MMRRC Submission

040470-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2882 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85234520-85270599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85267566 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 615 (H615Q)

Ref Sequence

ENSEMBL: ENSMUSP00000152840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000121930] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]

Predicted Effect

probably benign
Transcript: ENSMUST00000008966

SMART Domains

Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000019378
AA Change: H615Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: H615Q

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117138

SMART Domains

Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121930

SMART Domains

Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	64	156	4.5e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166821
AA Change: H615Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: H615Q

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000220854
AA Change: H615Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000223230

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	A	13: 59,742,943	Q354H	probably benign	Het
AF529169	C	T	9: 89,602,802	V181I	possibly damaging	Het
Atp9a	T	C	2: 168,706,214	Y7C	probably damaging	Het
Atxn3	C	A	12: 101,937,411	L178F	probably damaging	Het
Cep112	T	C	11: 108,519,212	S211P	possibly damaging	Het
Csl	A	G	10: 99,758,925	F93L	probably damaging	Het
Cyp4f40	A	G	17: 32,668,073	I173V	probably benign	Het
Dcaf17	A	G	2: 71,082,027	I319V	possibly damaging	Het
Dock5	T	C	14: 67,839,620	Y258C	probably damaging	Het
Dpp10	T	C	1: 123,445,203	E236G	probably damaging	Het
Dpyd	A	G	3: 119,065,030	D631G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Fat2	C	A	11: 55,311,305	L314F	probably damaging	Het
Gsdmc	T	C	15: 63,779,795	I259V	probably benign	Het
Hydin	C	T	8: 110,566,923	L3501F	possibly damaging	Het
Kdm2a	A	G	19: 4,331,184		probably null	Het
Klra1	A	T	6: 130,377,863		probably null	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Mmp12	A	G	9: 7,358,236	Y374C	probably damaging	Het
Mpp2	T	C	11: 102,064,633	E97G	probably benign	Het
Oasl2	C	T	5: 114,911,023	R175C	probably damaging	Het
Olfr348	A	T	2: 36,787,190	I222F	probably damaging	Het
Pcdhac2	A	T	18: 37,145,812	Q615L	probably damaging	Het
Ppm1h	T	A	10: 122,941,334	Y502N	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tgm6	T	C	2: 130,137,439	V163A	probably benign	Het
Tlr5	C	T	1: 182,973,893	T240M	probably damaging	Het
Washc4	T	C	10: 83,579,501	I785T	possibly damaging	Het

Other mutations in Mlh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Mlh3	APN	12	85267929	missense	probably benign
IGL01462:Mlh3	APN	12	85266736	missense	probably benign
IGL01961:Mlh3	APN	12	85266344	missense	probably benign	0.00
IGL02596:Mlh3	APN	12	85240958	critical splice donor site	probably null
IGL03008:Mlh3	APN	12	85240851	missense	probably benign	0.23
IGL03142:Mlh3	APN	12	85250301	critical splice donor site	probably null
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0078:Mlh3	UTSW	12	85268818	missense	probably damaging	0.98
R0129:Mlh3	UTSW	12	85266140	splice site	probably benign
R0269:Mlh3	UTSW	12	85268405	missense	probably benign	0.00
R0393:Mlh3	UTSW	12	85267587	nonsense	probably null
R0403:Mlh3	UTSW	12	85268968	missense	possibly damaging	0.93
R0409:Mlh3	UTSW	12	85240854	missense	possibly damaging	0.95
R0587:Mlh3	UTSW	12	85266419	missense	probably benign	0.00
R0701:Mlh3	UTSW	12	85267903	missense	probably benign	0.00
R0718:Mlh3	UTSW	12	85247697	missense	possibly damaging	0.86
R0883:Mlh3	UTSW	12	85235714	missense	possibly damaging	0.89
R0989:Mlh3	UTSW	12	85269395	missense	probably benign	0.22
R0990:Mlh3	UTSW	12	85267765	missense	probably benign
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1562:Mlh3	UTSW	12	85266920	missense	probably benign	0.14
R1599:Mlh3	UTSW	12	85268369	missense	probably damaging	1.00
R1694:Mlh3	UTSW	12	85267141	missense	probably damaging	1.00
R1777:Mlh3	UTSW	12	85268754	missense	possibly damaging	0.75
R1822:Mlh3	UTSW	12	85266145	splice site	probably benign
R1874:Mlh3	UTSW	12	85237513	critical splice donor site	probably null
R1914:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R1915:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R2075:Mlh3	UTSW	12	85269141	nonsense	probably null
R2083:Mlh3	UTSW	12	85269041	missense	probably benign	0.16
R2267:Mlh3	UTSW	12	85260811	missense	possibly damaging	0.55
R2334:Mlh3	UTSW	12	85268077	missense	probably benign	0.00
R3623:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3624:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3963:Mlh3	UTSW	12	85268680	missense	possibly damaging	0.94
R4376:Mlh3	UTSW	12	85259198	missense	probably benign	0.00
R5334:Mlh3	UTSW	12	85245761	critical splice donor site	probably null
R5526:Mlh3	UTSW	12	85269373	nonsense	probably null
R5556:Mlh3	UTSW	12	85268493	nonsense	probably null
R5611:Mlh3	UTSW	12	85267445	missense	probably benign	0.21
R5911:Mlh3	UTSW	12	85268455	missense	probably damaging	1.00
R6050:Mlh3	UTSW	12	85240846	missense	possibly damaging	0.89
R6221:Mlh3	UTSW	12	85268418	missense	possibly damaging	0.94
R6377:Mlh3	UTSW	12	85268497	missense	probably damaging	0.97
R6820:Mlh3	UTSW	12	85247723	missense	probably damaging	1.00
R6826:Mlh3	UTSW	12	85245824	missense	probably benign	0.38
R6992:Mlh3	UTSW	12	85235720	missense	probably damaging	1.00
R7217:Mlh3	UTSW	12	85266707	missense	probably benign
R7228:Mlh3	UTSW	12	85235656	missense	probably benign	0.07
R7348:Mlh3	UTSW	12	85267441	missense	probably damaging	0.99
R7599:Mlh3	UTSW	12	85268199	nonsense	probably null
R7722:Mlh3	UTSW	12	85267492	missense	probably benign	0.01
R7762:Mlh3	UTSW	12	85268284	missense	possibly damaging	0.63
R7786:Mlh3	UTSW	12	85266737	missense	probably benign	0.00
R8231:Mlh3	UTSW	12	85260798	critical splice donor site	probably null
R8415:Mlh3	UTSW	12	85269080	missense	probably benign	0.35
RF014:Mlh3	UTSW	12	85268029	missense	probably benign
X0024:Mlh3	UTSW	12	85247669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAACCTTTTGTTGGGCGG -3'
(R):5'- TGTCATGGCTGCCAACATTCC -3'

Sequencing Primer
(F):5'- CGGTTGACTGGATTCTTTACTTAAAG -3'
(R):5'- TGACATTCCGAGTCAACTGG -3'

Posted On

2015-01-23