Mutagenetix > Incidental Mutation

Incidental Mutation 'R2882:Dock5'

260362

Institutional Source

Beutler Lab

Gene Symbol

Dock5

Ensembl Gene

ENSMUSG00000044447

Gene Name

dedicator of cytokinesis 5

Synonyms

lr2, 1110060D06Rik, rlc

MMRRC Submission

040470-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.321) question?

Stock #

R2882 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67752135-67933442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67839620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 258 (Y258C)

Ref Sequence

ENSEMBL: ENSMUSP00000036674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039135]

AlphaFold

B2RY04

Predicted Effect

probably damaging
Transcript: ENSMUST00000039135
AA Change: Y258C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: Y258C

Domain	Start	End	E-Value	Type
SH3	11	68	1.45e-13	SMART
Pfam:DOCK_N	71	434	9e-110	PFAM
Pfam:DOCK-C2	439	636	1.1e-57	PFAM
low complexity region	752	764	N/A	INTRINSIC
Pfam:DHR-2	1133	1635	6.4e-99	PFAM
low complexity region	1663	1692	N/A	INTRINSIC
low complexity region	1815	1824	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224823

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	A	13: 59,742,943	Q354H	probably benign	Het
AF529169	C	T	9: 89,602,802	V181I	possibly damaging	Het
Atp9a	T	C	2: 168,706,214	Y7C	probably damaging	Het
Atxn3	C	A	12: 101,937,411	L178F	probably damaging	Het
Cep112	T	C	11: 108,519,212	S211P	possibly damaging	Het
Csl	A	G	10: 99,758,925	F93L	probably damaging	Het
Cyp4f40	A	G	17: 32,668,073	I173V	probably benign	Het
Dcaf17	A	G	2: 71,082,027	I319V	possibly damaging	Het
Dpp10	T	C	1: 123,445,203	E236G	probably damaging	Het
Dpyd	A	G	3: 119,065,030	D631G	probably damaging	Het
Ewsr1	C	A	11: 5,078,523		probably benign	Het
Fat2	C	A	11: 55,311,305	L314F	probably damaging	Het
Gsdmc	T	C	15: 63,779,795	I259V	probably benign	Het
Hydin	C	T	8: 110,566,923	L3501F	possibly damaging	Het
Kdm2a	A	G	19: 4,331,184		probably null	Het
Klra1	A	T	6: 130,377,863		probably null	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Mlh3	A	T	12: 85,267,566	H615Q	probably damaging	Het
Mmp12	A	G	9: 7,358,236	Y374C	probably damaging	Het
Mpp2	T	C	11: 102,064,633	E97G	probably benign	Het
Oasl2	C	T	5: 114,911,023	R175C	probably damaging	Het
Olfr348	A	T	2: 36,787,190	I222F	probably damaging	Het
Pcdhac2	A	T	18: 37,145,812	Q615L	probably damaging	Het
Ppm1h	T	A	10: 122,941,334	Y502N	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tex15	T	A	8: 33,574,907	L1455*	probably null	Het
Tgm6	T	C	2: 130,137,439	V163A	probably benign	Het
Tlr5	C	T	1: 182,973,893	T240M	probably damaging	Het
Washc4	T	C	10: 83,579,501	I785T	possibly damaging	Het

Other mutations in Dock5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Dock5	APN	14	67786889	splice site	probably benign
IGL00930:Dock5	APN	14	67771077	missense	probably damaging	1.00
IGL01525:Dock5	APN	14	67805720	splice site	probably benign
IGL01759:Dock5	APN	14	67881259	nonsense	probably null
IGL01941:Dock5	APN	14	67812232	missense	probably damaging	1.00
IGL02025:Dock5	APN	14	67763287	missense	probably damaging	1.00
IGL02093:Dock5	APN	14	67839543	splice site	probably benign
IGL02179:Dock5	APN	14	67806496	splice site	probably benign
IGL02208:Dock5	APN	14	67828450	missense	probably benign	0.06
IGL02605:Dock5	APN	14	67828438	missense	probably benign	0.18
IGL02608:Dock5	APN	14	67828439	missense	probably benign	0.01
IGL02938:Dock5	APN	14	67757218	splice site	probably benign
IGL02971:Dock5	APN	14	67757109	missense	probably null	1.00
IGL02983:Dock5	APN	14	67764670	missense	probably damaging	1.00
IGL03151:Dock5	APN	14	67866067	missense	probably damaging	1.00
IGL03410:Dock5	APN	14	67846086	missense	probably benign	0.04
PIT4366001:Dock5	UTSW	14	67824674	missense	possibly damaging	0.83
R0026:Dock5	UTSW	14	67846081	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0112:Dock5	UTSW	14	67819641	missense	probably benign
R0127:Dock5	UTSW	14	67846042	missense	probably benign	0.13
R0144:Dock5	UTSW	14	67786286	missense	probably benign	0.18
R0312:Dock5	UTSW	14	67795991	missense	possibly damaging	0.82
R0360:Dock5	UTSW	14	67822680	splice site	probably benign
R0364:Dock5	UTSW	14	67822680	splice site	probably benign
R0496:Dock5	UTSW	14	67817518	missense	probably damaging	1.00
R0506:Dock5	UTSW	14	67784792	splice site	probably benign
R0586:Dock5	UTSW	14	67809032	missense	probably damaging	1.00
R0597:Dock5	UTSW	14	67784934	splice site	probably null
R0625:Dock5	UTSW	14	67841163	missense	probably benign
R1109:Dock5	UTSW	14	67806478	missense	possibly damaging	0.80
R1221:Dock5	UTSW	14	67759161	missense	probably benign	0.00
R1278:Dock5	UTSW	14	67839566	missense	possibly damaging	0.80
R1927:Dock5	UTSW	14	67846062	missense	possibly damaging	0.60
R1944:Dock5	UTSW	14	67757135	nonsense	probably null
R1946:Dock5	UTSW	14	67786316	missense	probably damaging	1.00
R2046:Dock5	UTSW	14	67812142	missense	probably benign
R2101:Dock5	UTSW	14	67794010	missense	probably benign	0.02
R2252:Dock5	UTSW	14	67784812	missense	probably damaging	0.98
R3110:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R3112:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R4236:Dock5	UTSW	14	67756492	missense	probably benign	0.02
R4242:Dock5	UTSW	14	67828490	missense	probably benign	0.19
R4244:Dock5	UTSW	14	67774582	missense	probably benign	0.41
R4646:Dock5	UTSW	14	67842779	missense	probably benign	0.01
R4793:Dock5	UTSW	14	67800354	missense	probably benign	0.26
R4841:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R4842:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R5159:Dock5	UTSW	14	67792289	missense	probably benign	0.04
R5164:Dock5	UTSW	14	67817661	nonsense	probably null
R5206:Dock5	UTSW	14	67763184	missense	probably benign	0.35
R5207:Dock5	UTSW	14	67776284	missense	probably benign	0.06
R5322:Dock5	UTSW	14	67770266	missense	probably benign	0.41
R5374:Dock5	UTSW	14	67805756	missense	possibly damaging	0.81
R5413:Dock5	UTSW	14	67764655	missense	probably damaging	1.00
R5476:Dock5	UTSW	14	67814007	missense	possibly damaging	0.92
R5504:Dock5	UTSW	14	67803086	missense	probably benign	0.01
R5677:Dock5	UTSW	14	67777603	missense	probably benign	0.00
R5773:Dock5	UTSW	14	67796058	missense	possibly damaging	0.95
R5845:Dock5	UTSW	14	67841101	missense	possibly damaging	0.82
R5957:Dock5	UTSW	14	67857994	missense	probably benign
R6154:Dock5	UTSW	14	67859912	missense	probably benign	0.03
R6268:Dock5	UTSW	14	67790275	nonsense	probably null
R6393:Dock5	UTSW	14	67822602	missense	probably benign	0.32
R6512:Dock5	UTSW	14	67824648	missense	possibly damaging	0.93
R6759:Dock5	UTSW	14	67795996	missense	probably benign	0.00
R7012:Dock5	UTSW	14	67822586	missense	probably damaging	1.00
R7061:Dock5	UTSW	14	67770254	missense	probably damaging	0.96
R7196:Dock5	UTSW	14	67756470	missense	probably damaging	1.00
R7200:Dock5	UTSW	14	67771702	nonsense	probably null
R7311:Dock5	UTSW	14	67828502	missense	probably benign	0.25
R7359:Dock5	UTSW	14	67765888	missense	probably benign	0.10
R7422:Dock5	UTSW	14	67809030	missense	probably benign	0.01
R7588:Dock5	UTSW	14	67763158	critical splice donor site	probably null
R7637:Dock5	UTSW	14	67786340	missense	possibly damaging	0.95
R7709:Dock5	UTSW	14	67796005	missense	probably benign	0.44
R7763:Dock5	UTSW	14	67821327	missense	probably damaging	0.97
R8044:Dock5	UTSW	14	67824692	missense	probably damaging	1.00
R8076:Dock5	UTSW	14	67802977	splice site	probably null
R8168:Dock5	UTSW	14	67770197	splice site	probably null
R8353:Dock5	UTSW	14	67817508	splice site	probably null
R8480:Dock5	UTSW	14	67836410	missense	probably benign	0.32
R8535:Dock5	UTSW	14	67793976	missense	probably benign	0.19
R8708:Dock5	UTSW	14	67767371	missense	probably benign	0.02
R8732:Dock5	UTSW	14	67846000	missense	possibly damaging	0.85
R8888:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8895:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8936:Dock5	UTSW	14	67845990	nonsense	probably null
R8962:Dock5	UTSW	14	67757191	missense	probably benign
R8972:Dock5	UTSW	14	67776300	missense	probably damaging	1.00
R9244:Dock5	UTSW	14	67759114	missense	probably damaging	0.99
R9345:Dock5	UTSW	14	67822622	missense	possibly damaging	0.74
R9679:Dock5	UTSW	14	67781001	missense	probably damaging	1.00
X0023:Dock5	UTSW	14	67771088	missense	probably benign	0.15
Z1177:Dock5	UTSW	14	67813933	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GCACTGTATCCACTGTAAGAAAAC -3'
(R):5'- GACTCTTCCAAAGGCAGAAGC -3'

Sequencing Primer
(F):5'- TGCAAATGGGCTTCTGACC -3'
(R):5'- AGTGTATCTGTGAGCAGC -3'

Posted On

2015-01-23